TkAUNG021250 | RubberDandelionOmics

Gene overview

TkAUNG021250

Reference: TK1151 Chr: ChrUn Coordinates: 5675232-5678383 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1943 bp · TkAUNG021250|TK1151|cDNA

AAGAAAAAAGTTTTGGATGAAAGATACGGTCGATAAAACCGACGTGGACACAGGATAACCACCACATTGGGACAACACCAACTGTCATCCTCTTCACCACAACTTCATACGAATTTCCAAGGAATTCGAATTCCAGAACATCTCAATTCTCTACAAACAAAGTGAAGTTCGCCGATGAAATACTTCAGTTGCAACAACTAGAATGGCGTTAACAACTCCGATTACCTCATCTTCACAGTTAATTCAGTTACCAGTGATTC...

CDS

Download CDS FASTA

792 bp · TkAUNG021250|TK1151|CDS

ATGGCGTTAACAACTCCGATTACCTCATCTTCACAGTTAATTCAGTTACCAGTGATTCACCCGTCATCTTCGTCTCATTACGTTCCGTTTAGGGGATACGCCTTGATCCGGTCAAAATTTCAAGTGATCGCTCTGCGGACCGCTGGGAGTTCCGTATTTCCTGTTCCATCGAAAGTCTCGTCGACTGTTAGCTTTAGGTGTTGTGCAAAATCGACGGAGGAGAAAGAGGCGGAGACTTTAACAAGTGACAACGATGATAA...

Protein

Download Protein FASTA

263 aa · TkAUNG021250|TK1151|PROTEIN

MALTTPITSSSQLIQLPVIHPSSSSHYVPFRGYALIRSKFQVIALRTAGSSVFPVPSKVSSTVSFRCCAKSTEEKEAETLTSDNDDNPREETHLSSNDSVKVEDGGSRKNIPSLSDALNLGIREPVYEVVEVSSTGMVSTRKINRRDLLKSSGLRPRDIRSVDPSLWLTNTMPSLLVRENAILLNLGALRAIAMQESVFIFNYNRRAGKAFIDALLPRLNPKSTHGGPVMPFELEVVEAALHSRIQRFEDRLMELDPRVS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG021250`
TK1151 ID	TkAUNG021250
OH-1004 ID	LXL04_013108
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	96.900
Protein coverage (%)	TK1151 98.479 / OH-1004 56.923 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG021250

Location ChrUn:5675232-5678383 (-)

Description Similar to MRS2-11: Magnesium transporter MRS2-11, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g22830`	High-affinity magnesium transporter that mediates the influx of magnesium in chloroplast.	A novel family of magnesium transport genes in Arabidopsis.2001 · DOI: 10.1105/tpc.010352

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: B8APK3`	Magnesium transporter that may mediate the influx of magnesium in chloroplast.	No verified direct reference in this release
`Os03g0684400`	Magnesium transporter that may mediate the influx of magnesium in chloroplast.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013108 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0010027 thylakoid membrane organization Biological Process

GO:0010117 photoprotection Biological Process

GO:0010960 magnesium ion homeostasis Biological Process

GO:0015693 magnesium ion transport Biological Process

GO:0045016 mitochondrial magnesium ion transmembrane transport Biological Process

GO:1903830 magnesium ion transmembrane transport Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0031969 chloroplast membrane Cellular Component

KEGG gene cross-reference

ago:AGOS_ADR359W

ath:AT5G22830

dosa:Os03g0684400

spo:2540385

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.966

Rank 1 · TkAUNG021250 · TK1151

Nucleus0.033

Rank 2 · TkAUNG021250 · TK1151

Mitochondrion0.027

Rank 3 · TkAUNG021250 · TK1151

Cytoplasm0.014

Rank 4 · TkAUNG021250 · TK1151

Cell membrane0.012

Rank 5 · TkAUNG021250 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22099MRS2-like138-252 aa

PF10518TAT_signal142-153 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG021250	`PF22099`	MRS2-like	138	252	2.5e-18	66.9
TkAUNG021250	`PF10518`	TAT_signal	142	153	0.27	12.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q058N4`	Arabidopsis thaliana	sp\|Q058N4\|MRS2B_ARATH Magnesium transporter MRS2-11, chloroplastic	75.000%	Swiss-Prot	Medium
`B8APK3`	Oryza sativa subsp. indica	sp\|B8APK3\|MRS2A_ORYSI Magnesium transporter MRS2-A, chloroplastic	73.600%	Swiss-Prot	Medium
`Q9AUK4`	Oryza sativa subsp. japonica	sp\|Q9AUK4\|MRS2A_ORYSJ Magnesium transporter MRS2-A, chloroplastic	73.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card