Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1246 bp · TkAUNG019670|TK1151|cDNA
CAAATATTTATTCAATCTTCTTCTTCCCGGGTTTCTTTTATTCAATCGTTCCCTTTAAAAAAACACCAAATCACTATTGTTTCAACCTCCATCCATCTCTTTCTCTCTGCAACAACAATGGAGAACAAGTTACATGGCTTGCCTCCTCACAAACGATTCAGGTTACTTCACCCAGAAAACCCCACCATTAATCACCAAAACTCCAATTCACCGATTTCTTCAATCCTTCCGGCAAAAAAGAGAAAAGAATCTCGCGACCT...
1086 bp · TkAUNG019670|TK1151|CDS
CAAATATTTATTCAATCTTCTTCTTCCCGGGTTTCTTTTATTCAATCGTTCCCTTTAAAAAAACACCAAATCACTATTGTTTCAACCTCCATCCATCTCTTTCTCTCTGCAACAACAATGGAGAACAAGTTACATGGCTTGCCTCCTCACAAACGATTCAGGTTACTTCACCCAGAAAACCCCACCATTAATCACCAAAACTCCAATTCACCGATTTCTTCAATCCTTCCGGCAAAAAAGAGAAAAGAATCTCGCGACCT...
Protein
Download Protein FASTA361 aa · TkAUNG019670|TK1151|PROTEIN
QIFIQSSSSRVSFIQSFPLKKHQITIVSTSIHLFLSATTMENKLHGLPPHKRFRLLHPENPTINHQNSNSPISSILPAKKRKESRDLPSFLTNPEPVASTTYCLPAKKRICAFHPNILPAKPISPFDLNLDYDPKLENDNDSVIVNVSEKREEIDDVRAEEEEEEEVDEDGILCAVCQSTDGDPSDPIVFCDGCDLMVHTTCYGDPLIKGVPEGDWFCSQCQITDKNKDVCCCFCPVNGGALKPIGNGQWAHIVCALFIP...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkAUNG019670 |
|---|---|
| TK1151 ID | TkAUNG019670 |
| OH-1004 ID | LXL04_039756 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 97.800 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 96.257Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkAUNG019670 |
|---|---|
| Location | ChrUn:5263610-5264948 (-) |
| Description | Similar to Jade1: Protein Jade-1 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0001558 regulation of cell growth Biological Process GO:0006275 regulation of DNA replication Biological Process GO:0006338 chromatin remodeling Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006355 regulation of DNA-templated transcription Biological Process GO:0006357 regulation of transcription by RNA polymerase II Biological Process GO:0030308 negative regulation of cell growth Biological Process GO:0051726 regulation of cell cycle Biological Process GO:0060828 regulation of canonical Wnt signaling pathway Biological Process GO:0090090 negative regulation of canonical Wnt signaling pathway Biological Process GO:2000134 negative regulation of G1/S transition of mitotic cell cycle Biological Process GO:2000278 regulation of DNA biosynthetic process Biological Process |
| KEGG gene cross-reference | bta:509264 hsa:79960 mmu:269424 sce:YPR031W These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF13832zf-HC5HC2H_2150-203 aaPF13771zf-HC5HC2H150-203 aaPF13831PHD_2166-177 aaPF03107C1_2169-202 aaPF14446Prok-RING_1171-203 aaPF22289DmmA-like_C172-197 aaPF00130C1_1173-203 aaPF00628PHD174-221 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkAUNG019670 | PF13832 | zf-HC5HC2H_2 | 150 | 203 | 2.6e-29 | 102.3 |
| TkAUNG019670 | PF13771 | zf-HC5HC2H | 150 | 203 | 1.5e-18 | 67.5 |
| TkAUNG019670 | PF13831 | PHD_2 | 166 | 177 | 1.2e-08 | 35.0 |
| TkAUNG019670 | PF03107 | C1_2 | 169 | 202 | 0.016 | 16.2 |
| TkAUNG019670 | PF14446 | Prok-RING_1 | 171 | 203 | 0.029 | 15.2 |
| TkAUNG019670 | PF22289 | DmmA-like_C | 172 | 197 | 0.14 | 12.9 |
| TkAUNG019670 | PF00130 | C1_1 | 173 | 203 | 0.11 | 13.1 |
| TkAUNG019670 | PF00628 | PHD | 174 | 221 | 1.4e-10 | 41.8 |
| TkAUNG019670 | PF21202 | SLX1_C | 174 | 209 | 2.6 | 9.1 |
| TkAUNG019670 | PF13831 | PHD_2 | 186 | 221 | 1.2e-08 | 35.0 |
| TkAUNG019670 | PF03107 | C1_2 | 213 | 234 | 0.016 | 16.2 |
| TkAUNG019670 | PF00130 | C1_1 | 216 | 224 | 0.11 | 13.1 |
| TkAUNG019670 | PF22289 | DmmA-like_C | 217 | 235 | 0.14 | 12.9 |
| TkAUNG019670 | PF21202 | SLX1_C | 218 | 234 | 2.6 | 9.1 |
| TkAUNG019670 | PF13771 | zf-HC5HC2H | 222 | 241 | 1.5e-18 | 67.5 |
| TkAUNG019670 | PF00628 | PHD | 227 | 236 | 1.4e-10 | 41.8 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.