RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkAUNG013130
Reference: TK1151 Chr: ChrUn Coordinates: 3351288-3354095 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1242 bp · TkAUNG013130|TK1151|cDNA

GCCTCTTGCCAAGAGAAAAGAACGCAATATCAATAAGCTTTCTTTCAATGCTTCTTCGAGCTTCCAAATATTTAGACACAACGGTTTCATGCAAGCTGGATTTAGAGAAAAGAATGGGATTACAACTCGGGCAGGCAGTTCTAGACGACATATTGATTCCTTCTTTTTGCTTTGATGGTGATACGTTGTTTGATGTTGATACAGTTCAACAAATGATGATGATTTATGTTGAAAACAATTTTTCAGACACGTGTGCTAAT...

CDS

Download CDS FASTA

1002 bp · TkAUNG013130|TK1151|CDS

ATGCTTCTTCGAGCTTCCAAATATTTAGACACAACGGTTTCATGCAAGCTGGATTTAGAGAAAAGAATGGGATTACAACTCGGGCAGGCAGTTCTAGACGACATATTGATTCCTTCTTTTTGCTTTGATGGTGATACGTTGTTTGATGTTGATACAGTTCAACAAATGATGATGATTTATGTTGAAAACAATTTTTCAGACACGTGTGCTAATGCTATAGACCATGTGTCACCAACAGAAAGTGACGATGAAAATGTCGG...

Protein

Download Protein FASTA

333 aa · TkAUNG013130|TK1151|PROTEIN

MLLRASKYLDTTVSCKLDLEKRMGLQLGQAVLDDILIPSFCFDGDTLFDVDTVQQMMMIYVENNFSDTCANAIDHVSPTESDDENVGRIMETFLAKIASDRNLWVAKFISFAECIPSQVKVTEDGMYRAIDIYLKAHPGLSDMDRKKVCSLMDCQKLSREARAHAAQNERLPVQTVVQVLYYEQQRLQETTPGRANLSPIDQANSVSTPGTPNSRDQGNSVSDEISKLKKENQDLKFELLKMKTRLKEMERSNGNKPRVN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkAUNG013130
TK1151 IDTkAUNG013130
OH-1004 IDLXL04_036778
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)42.700
Protein coverage (%)TK1151 75.075 / OH-1004 43.046
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkAUNG013130
LocationChrUn:3351288-3354095 (+)
DescriptionSimilar to At5g48800: BTB/POZ domain-containing protein At5g48800
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g67385 Acts as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins (Probable). No verified direct reference in this release
At3g49970 May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. No verified direct reference in this release
At5g48800 May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. No verified direct reference in this release
At3g08660 May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. No verified direct reference in this release
UniProt: Q682S0 May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins (By similarity). No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_036778 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0009846 pollen germination Biological Process
GO:0009860 pollen tube growth Biological Process
GO:0016567 protein ubiquitination Biological Process
GO:0005634 nucleus Cellular Component
GO:0009507 chloroplast Cellular Component
KEGG gene cross-reference
ath:AT1G03010
ath:AT2G47860
ath:AT3G08570
ath:AT3G08660
ath:AT5G48800
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.413
Rank 1 · TkAUNG013130 · TK1151
Cytoplasm0.333
Rank 2 · TkAUNG013130 · TK1151
Cell membrane0.244
Rank 3 · TkAUNG013130 · TK1151
Endoplasmic reticulum0.092
Rank 4 · TkAUNG013130 · TK1151
Golgi apparatus0.051
Rank 5 · TkAUNG013130 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03000NPH32-161 aa
PF23511ISD11138-186 aa
PF06156YabA155-173 aa
PF06005ZapB155-172 aa
PF26052BRE1B174-188 aa
PF06156YabA217-256 aa
PF23511ISD11218-241 aa
PF12808Mto2_bdg219-243 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkAUNG013130PF03000NPH321613.4e-53181.7
TkAUNG013130PF23511ISD111381860.8810.4
TkAUNG013130PF06156YabA1551730.9610.8
TkAUNG013130PF06005ZapB1551721.110.5
TkAUNG013130PF26052BRE1B1741880.4411.1
TkAUNG013130PF06156YabA2172560.9610.8
TkAUNG013130PF23511ISD112182410.8810.4
TkAUNG013130PF12808Mto2_bdg2192430.009716.9
TkAUNG013130PF08286Spc242192550.1313.2
TkAUNG013130PF07989Cnn_1N2222530.002318.8
TkAUNG013130PF06005ZapB2222531.110.5
TkAUNG013130PF14916CCDC922232450.01615.7
TkAUNG013130PF26052BRE1B2252520.4411.1
TkAUNG013130PF12808Mto2_bdg2442510.009716.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q66GP0Arabidopsis thalianasp|Q66GP0|SR1P1_ARATH BTB/POZ domain-containing protein SR1IP153.800%Swiss-ProtHigh
Q9SN21Arabidopsis thalianasp|Q9SN21|Y3997_ARATH Putative BTB/POZ domain-containing protein At3g4997046.200%Swiss-ProtMedium
Q9FKB6Arabidopsis thalianasp|Q9FKB6|Y5880_ARATH BTB/POZ domain-containing protein At5g4880042.400%Swiss-ProtMedium
Q9C9Z0Arabidopsis thalianasp|Q9C9Z0|Y3866_ARATH Putative BTB/POZ domain-containing protein At3g0866038.400%Swiss-ProtMedium
Q682S0Arabidopsis thalianasp|Q682S0|RPT2_ARATH Root phototropism protein 237.200%Swiss-ProtMedium

JBrowse

View in Genome Browser