TkAUNG010760 | RubberDandelionOmics

Gene overview

TkAUNG010760

Reference: TK1151 Chr: ChrUn Coordinates: 2598903-2599858 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

579 bp · TkAUNG010760|TK1151|cDNA

ATGACTTCGAAATCGAGGTCTAATTTGTCTGGTAATGACAAATCATGTAAAGAGATAAAATTGCCGGTCGGGTATAGATTCGACCCAACAGATGTGGAATTATTGGAGCATTATTTGATTCCTAAGCTAAATGGTGAAAAGCTCCCTTCTGAGTATGTTATGGATCTTGATGTCTACCAATATGAGCCTCATCAACTTCCTTTGGATAAATTCAAGCATGCTAAGGAGAAGCAAGCATACTTCTTCACTGAGGATACAAG...

CDS

Download CDS FASTA

579 bp · TkAUNG010760|TK1151|CDS

ATGACTTCGAAATCGAGGTCTAATTTGTCTGGTAATGACAAATCATGTAAAGAGATAAAATTGCCGGTCGGGTATAGATTCGACCCAACAGATGTGGAATTATTGGAGCATTATTTGATTCCTAAGCTAAATGGTGAAAAGCTCCCTTCTGAGTATGTTATGGATCTTGATGTCTACCAATATGAGCCTCATCAACTTCCTTTGGATAAATTCAAGCATGCTAAGGAGAAGCAAGCATACTTCTTCACTGAGGATACAAG...

Protein

Download Protein FASTA

192 aa · TkAUNG010760|TK1151|PROTEIN

MTSKSRSNLSGNDKSCKEIKLPVGYRFDPTDVELLEHYLIPKLNGEKLPSEYVMDLDVYQYEPHQLPLDKFKHAKEKQAYFFTEDTRLKNPEDQVRTWCWKICNEDIPIYRNNESIIGFKTKLYFHDSNGNKTDWKMIEYRCHPNQIIVVDIKCFIICKVKQKMKIEEELSEEESSERENGNNLANHWLKAI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG010760`
TK1151 ID	TkAUNG010760
OH-1004 ID	LXL04_025939
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	35.300
Protein coverage (%)	TK1151 75.000 / OH-1004 43.732 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG010760

Location ChrUn:2598903-2599858 (-)

Description Similar to NAC098: Protein CUP-SHAPED COTYLEDON 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g61110`	Transcription factor of the NAC family.	A cis regulatory element in the TAPNAC promoter directs tapetal gene expression.2011 · DOI: 10.1007/s11103-010-9713-5
`At1g26870`	Promotes periclinal root capforming cell divisions.	No verified direct reference in this release
`At1g77450`	Transcriptional activator that positively regulates age-dependent senescence, dark-induced leaf senescence and stress-induced senescence.	No verified direct reference in this release
`At1g12260`	Transcription activator that binds to the secondary wall NAC binding element (SNBE), 5'-(T/A)NN(C/T)(T/C/G)TNNNNNNNA(A/C)GN(A/C/T)(A/T)-3', in the promoter of target genes (By similarity).	Arabidopsis NAC domain proteins, VND1 to VND5, are transcriptional regulators of secondary wall biosynthesis in vessels.2014 · DOI: 10.1371/journal.pone.0105726

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0815100`	Transcription factor that possesses transactivation activity.	Overexpressing a NAM, ATAF, and CUC (NAC) transcription factor enhances drought resistance and salt tolerance in rice.2006 · DOI: 10.1073/pnas.0604882103 The abiotic stress-responsive NAC-type transcription factor OsNAC5 regulates stress-inducible genes and stress tolerance in rice.2010 · DOI: 10.1007/s00438-010-0557-0

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025939 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009723 response to ethylene Biological Process

GO:0009733 response to auxin Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009740 gibberellic acid mediated signaling pathway Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0010029 regulation of seed germination Biological Process

KEGG gene cross-reference

ath:AT5G07680

ath:AT5G39610

ath:AT5G53950

ath:AT5G61430

dosa:Os04g0460600

osa:4336052

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.886

Rank 1 · TkAUNG010760 · TK1151

Cytoplasm0.180

Rank 2 · TkAUNG010760 · TK1151

Cell membrane0.042

Rank 3 · TkAUNG010760 · TK1151

Endoplasmic reticulum0.024

Rank 4 · TkAUNG010760 · TK1151

Mitochondrion0.014

Rank 5 · TkAUNG010760 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02365NAM22-141 aa

PF29679Ponticulin_N96-158 aa

PF10214Rrn6_beta-prop129-173 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG010760	`PF02365`	NAM	22	141	7.9e-28	98.1
TkAUNG010760	`PF29679`	Ponticulin_N	96	158	0.19	13.1
TkAUNG010760	`PF10214`	Rrn6_beta-prop	129	173	0.0094	15.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GY42`	Arabidopsis thaliana	sp\|Q8GY42\|NAC25_ARATH NAC transcription factor 25	35.400%	Swiss-Prot	Medium
`Q9ZVH0`	Arabidopsis thaliana	sp\|Q9ZVH0\|FEZ_ARATH Protein FEZ	37.200%	Swiss-Prot	Medium
`Q9CAR0`	Arabidopsis thaliana	sp\|Q9CAR0\|NAC32_ARATH NAC transcription factor 32	37.800%	Swiss-Prot	Medium
`Q9FWX2`	Arabidopsis thaliana	sp\|Q9FWX2\|NAC7_ARATH NAC domain-containing protein 7	31.600%	Swiss-Prot	Medium
`Q75HE5`	Oryza sativa subsp. japonica	sp\|Q75HE5\|NAC2_ORYSJ NAC domain-containing protein 2	38.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card