TkAUNG009920 | RubberDandelionOmics

Gene overview

TkAUNG009920

Reference: TK1151 Chr: ChrUn Coordinates: 2455159-2456504 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

903 bp · TkAUNG009920|TK1151|cDNA

ATGTTAAGAGGTTCAGGGGTATGCTGGGATTTGCGAAGAGCAGCACCTTACGATGTTCATGACCAATTGGATCCTGACGTACCAGTAGGTACCAGAGGAGATCGCTATGATCGTTACTGTATTCGTATCGAAGAGATGCGACAAAGTGTTCGGATCATTGTGCAATGTCTTAATCAAATGCCTAGTGGCATGATCAAAGCCGATGATCGTAAGCTATGTCCTCCATCACGATGTCGAATGAAACTATCCATGGAATCCAT...

CDS

Download CDS FASTA

903 bp · TkAUNG009920|TK1151|CDS

ATGTTAAGAGGTTCAGGGGTATGCTGGGATTTGCGAAGAGCAGCACCTTACGATGTTCATGACCAATTGGATCCTGACGTACCAGTAGGTACCAGAGGAGATCGCTATGATCGTTACTGTATTCGTATCGAAGAGATGCGACAAAGTGTTCGGATCATTGTGCAATGTCTTAATCAAATGCCTAGTGGCATGATCAAAGCCGATGATCGTAAGCTATGTCCTCCATCACGATGTCGAATGAAACTATCCATGGAATCCAT...

Protein

Download Protein FASTA

300 aa · TkAUNG009920|TK1151|PROTEIN

MLRGSGVCWDLRRAAPYDVHDQLDPDVPVGTRGDRYDRYCIRIEEMRQSVRIIVQCLNQMPSGMIKADDRKLCPPSRCRMKLSMESIPRLAHLVERGEALGTPISFFGALSFPVPPPRHSASLPVLRKNPLTSPFFIDLGEKERSTSWEARHQVSGLMRITKLTRQSWLLAQEGGALPHRRRTRGSVRGGASGFQCTASKIRTSLPADHCRPILELGCWIRDPRSRLDQHPSERGQSLERTGCTYPRTLRLFLSSSRPLR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG009920`
TK1151 ID	TkAUNG009920
OH-1004 ID	LXL04_010611
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	72.300
Protein coverage (%)	TK1151 84.333 / OH-1004 22.460 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG009920

Location ChrUn:2455159-2456504 (+)

Description Similar to Probable cytochrome c biosynthesis protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`AtMg00510`	Core subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I) that is believed to belong to the minimal assembly required for catalysis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010611 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0017004 cytochrome complex assembly Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0032991 protein-containing complex Cellular Component

GO:0015232 heme transmembrane transporter activity Molecular Function

GO:0016491 oxidoreductase activity Molecular Function

GO:0020037 heme binding Molecular Function

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.438

Rank 1 · TkAUNG009920 · TK1151

Cytoplasm0.413

Rank 2 · TkAUNG009920 · TK1151

Mitochondrion0.168

Rank 3 · TkAUNG009920 · TK1151

Cell membrane0.086

Rank 4 · TkAUNG009920 · TK1151

Endoplasmic reticulum0.049

Rank 5 · TkAUNG009920 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00346Complex1_49kDa1-94 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG009920	`PF00346`	Complex1_49kDa	1	94	2.7e-31	109.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P93306`	Arabidopsis thaliana	sp\|P93306\|NDUS2_ARATH NADH dehydrogenase [ubiquinone] iron-sulfur protein 2	94.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card