TkAUNG005240 | RubberDandelionOmics

Gene overview

TkAUNG005240

Reference: TK1151 Chr: ChrUn Coordinates: 1547028-1549012 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1317 bp · TkAUNG005240|TK1151|cDNA

ATGTATCCTAATTTTTGGCCTAATTCTCTTCTGATGATTGATTCAACCTCTGATCAAAAAGATATACCTTGGTTATATTTCATCTCTTCAACAAGTTTAGTAATGAGCATAACGGCCCTATTGTTCCGATGGAGAGAGGAACCTATGATTAGCTTTTCGGGAAATTTCCAAACGAACAATTTCAACGAAATCTTTCAATTTCTTATTTTACTATGTTCAACTCTATGTATTCCTCTATCCGTAGAGTACATTGAATGTAC...

CDS

Download CDS FASTA

1317 bp · TkAUNG005240|TK1151|CDS

ATGTATCCTAATTTTTGGCCTAATTCTCTTCTGATGATTGATTCAACCTCTGATCAAAAAGATATACCTTGGTTATATTTCATCTCTTCAACAAGTTTAGTAATGAGCATAACGGCCCTATTGTTCCGATGGAGAGAGGAACCTATGATTAGCTTTTCGGGAAATTTCCAAACGAACAATTTCAACGAAATCTTTCAATTTCTTATTTTACTATGTTCAACTCTATGTATTCCTCTATCCGTAGAGTACATTGAATGTAC...

Protein

Download Protein FASTA

438 aa · TkAUNG005240|TK1151|PROTEIN

MYPNFWPNSLLMIDSTSDQKDIPWLYFISSTSLVMSITALLFRWREEPMISFSGNFQTNNFNEIFQFLILLCSTLCIPLSVEYIECTEMAITEFLLFVLTATIGGMFLCGANDLITIFVAPECFSLCSYLLSGYTKKDVRSNEATMKYLLMGGASSSILVHGFSWLYGSSGGEIELQEIVNGLINTQMYNSPGISIALIFITVGIGFKLSPAPSHQWTPDVYEGSPTPVVAFLSVTSKVAASASATRIFDIPFYFSSNEW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG005240`
TK1151 ID	TkAUNG005240
OH-1004 ID	LXL04_040170
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	25.400
Protein coverage (%)	TK1151 43.151 / OH-1004 43.499 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkAUNG005240`
Location	ChrUn:1547028-1549012 (-)
Description	Similar to ND5: NADH-ubiquinone oxidoreductase chain 5
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_040170` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0015990 electron transport coupled proton transport Biological Process GO:0042773 ATP synthesis coupled electron transport Biological Process GO:0005743 mitochondrial inner membrane Cellular Component GO:0009536 plastid Cellular Component GO:0045271 respiratory chain complex I Cellular Component GO:0003954 NADH dehydrogenase activity Molecular Function GO:0008137 NADH dehydrogenase (ubiquinone) activity Molecular Function
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.708

Rank 1 · TkAUNG005240 · TK1151

Endoplasmic reticulum0.102

Rank 2 · TkAUNG005240 · TK1151

Cytoplasm0.052

Rank 3 · TkAUNG005240 · TK1151

Cell membrane0.044

Rank 4 · TkAUNG005240 · TK1151

Peroxisome0.031

Rank 5 · TkAUNG005240 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19530Ndh2_N9-82 aa

PF00361Proton_antipo_M27-78 aa

PF00361Proton_antipo_M111-407 aa

PF19530Ndh2_N267-291 aa

PF19530Ndh2_N320-358 aa

PF19530Ndh2_N394-418 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG005240	`PF19530`	Ndh2_N	9	82	1.3e-36	125.6
TkAUNG005240	`PF00361`	Proton_antipo_M	27	78	2.4e-90	303.4
TkAUNG005240	`PF00361`	Proton_antipo_M	111	407	2.4e-90	303.4
TkAUNG005240	`PF19530`	Ndh2_N	267	291	1.3e-36	125.6
TkAUNG005240	`PF19530`	Ndh2_N	320	358	1.3e-36	125.6
TkAUNG005240	`PF19530`	Ndh2_N	394	418	1.3e-36	125.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card