TkAUNG004820 | RubberDandelionOmics

Gene overview

TkAUNG004820

Reference: TK1151 Chr: ChrUn Coordinates: 1440760-1442754 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1143 bp · TkAUNG004820|TK1151|cDNA

ATGAGCATAACGGCCCTATTGTTCCGATGGAGAGAGGAACCTATGATTAGCTTTTCGGGAAATTTCCAAACGAACAATTTCAACGAAATCTTTCAATTTCTTATTTTACTATGTTCAACTCTATGTATTCCTCTATCCGTAGAGTACATTGAATGTACAGAAATGGCTATAACAGAGTTTCTCTTATTCGTATTAACAGCTACTATAGGAGGAATGTTTTTATGCGGTGCTAACGATTTAATAACTATCTTTGTAGCTCC...

CDS

Download CDS FASTA

1143 bp · TkAUNG004820|TK1151|CDS

ATGAGCATAACGGCCCTATTGTTCCGATGGAGAGAGGAACCTATGATTAGCTTTTCGGGAAATTTCCAAACGAACAATTTCAACGAAATCTTTCAATTTCTTATTTTACTATGTTCAACTCTATGTATTCCTCTATCCGTAGAGTACATTGAATGTACAGAAATGGCTATAACAGAGTTTCTCTTATTCGTATTAACAGCTACTATAGGAGGAATGTTTTTATGCGGTGCTAACGATTTAATAACTATCTTTGTAGCTCC...

Protein

Download Protein FASTA

380 aa · TkAUNG004820|TK1151|PROTEIN

MSITALLFRWREEPMISFSGNFQTNNFNEIFQFLILLCSTLCIPLSVEYIECTEMAITEFLLFVLTATIGGMFLCGANDLITIFVAPECFSLCSYLLSGYTKKDVRSNEATMKYLLMGGASSSILVHGFSWLYGSSGGEIELQEIVNGLINTQMYNSPGISIALIFITVGIGFKLSPAPSHQWTPDVYEGVRCYIKEVRNPLFDSNSPTPVVAFLSVTSKVAASASATRIFDIPFYFSSNEWHLLLEILAILSMILGNLI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG004820`
TK1151 ID	TkAUNG004820
OH-1004 ID	LXL04_040170
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	22.900
Protein coverage (%)	TK1151 51.842 / OH-1004 41.608 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkAUNG004820`
Location	ChrUn:1440760-1442754 (+)
Description	Similar to ND5: NADH-ubiquinone oxidoreductase chain 5
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_040170` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0015990 electron transport coupled proton transport Biological Process GO:0042773 ATP synthesis coupled electron transport Biological Process GO:0005743 mitochondrial inner membrane Cellular Component GO:0009536 plastid Cellular Component GO:0045271 respiratory chain complex I Cellular Component GO:0003954 NADH dehydrogenase activity Molecular Function GO:0008137 NADH dehydrogenase (ubiquinone) activity Molecular Function
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.818

Rank 1 · TkAUNG004820 · TK1151

Cytoplasm0.056

Rank 2 · TkAUNG004820 · TK1151

Endoplasmic reticulum0.050

Rank 3 · TkAUNG004820 · TK1151

Cell membrane0.035

Rank 4 · TkAUNG004820 · TK1151

Nucleus0.030

Rank 5 · TkAUNG004820 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19530Ndh2_N1-48 aa

PF00361Proton_antipo_M77-190 aa

PF00361Proton_antipo_M206-360 aa

PF19530Ndh2_N249-272 aa

PF19530Ndh2_N302-340 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG004820	`PF19530`	Ndh2_N	1	48	2e-20	73.6
TkAUNG004820	`PF00361`	Proton_antipo_M	77	190	8.1e-76	255.7
TkAUNG004820	`PF00361`	Proton_antipo_M	206	360	8.1e-76	255.7
TkAUNG004820	`PF19530`	Ndh2_N	249	272	2e-20	73.6
TkAUNG004820	`PF19530`	Ndh2_N	302	340	2e-20	73.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card