TkA08G399070 | RubberDandelionOmics

Gene overview

TkA08G399070

Reference: TK1151 Chr: Chr08 Coordinates: 101703831-101706990 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1272 bp · TkA08G399070|TK1151|cDNA

TTTTTGCAGTTTTGTCTTAAAAAAATATATCGAAACTTCGTTGCTTGTTCACCATTGCTGAAAAATCAACTCAAAAAGATCCTAAATGATTCGGAAAATCATATCTGGTCGGATCTTCTTTTCCAAACTGTCAAAATCTTCAAATCCCACCTCCACAAATCATATGGGTCCTCTTAAAAAACCCAAATTCCTCCGATTCTTCATCCTCAAAACAAATTCAAAATGGGTGTTATTGCAGTCGCAAATGCCCCTCTTCATGT...

CDS

Download CDS FASTA

1050 bp · TkA08G399070|TK1151|CDS

ATGGGTGTTATTGCAGTCGCAAATGCCCCTCTTCATGTTCTTGCAGTTGATGACAGCAATCTTGACAGGAAATTGATTGAACGTCTTCTAAAGACCTTCTCATATCATGTTACTGCTGTGGATTCTGGAAGTAAGGCCTTGGAGTTTTTGGGTCTGCAAGATGTTGAAAAGCTTCCATCCTTTTCTCCTACCGATTGTCAGCCAGAAGTGGAGGTGAATTTGATTATTACCGATTATTGTATGCCTGGGATGACTGGTTA...

Protein

Download Protein FASTA

349 aa · TkA08G399070|TK1151|PROTEIN

MGVIAVANAPLHVLAVDDSNLDRKLIERLLKTFSYHVTAVDSGSKALEFLGLQDVEKLPSFSPTDCQPEVEVNLIITDYCMPGMTGYELLRKIKESTSLKDIPVVIMSSENEPARINRCLEEGAEEFFLKPVRLSDVDKLKPYLSKNKRKTEDEEECVSNEKSRVKYDNVEALSEEERLKFSEDQSSLFRPHSNYGGRAQRRPAVELGFRRHFNFPAKSEIERGILMVGMRQSRWQTIYLEIWREYNINATISFYIVADE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G399070`
TK1151 ID	TkA08G399070
OH-1004 ID	LXL04_034308
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.600
Protein coverage (%)	TK1151 95.415 / OH-1004 95.143 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G399070

Location Chr08:101703831-101706990 (+)

Description Similar to RR9: Two-component response regulator ORR9

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: B8BLZ4`	Functions as a response regulator involved in His-to-Asp phosphorelay signal transduction system.	No verified direct reference in this release
`Os12g0139400`	Functions as a response regulator involved in His-to-Asp phosphorelay signal transduction system.	No verified direct reference in this release
`UniProt: Q4GZK2`	Functions as a response regulator involved in His-to-Asp phosphorelay signal transduction system.	No verified direct reference in this release
`Os11g0143300`	Functions as a response regulator involved in His-to-Asp phosphorelay signal transduction system.	No verified direct reference in this release
`UniProt: Q4GZK7`	Functions as a response regulator involved in His-to-Asp phosphorelay signal transduction system.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_034308 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000160 phosphorelay signal transduction system Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009735 response to cytokinin Biological Process

GO:0009736 cytokinin-activated signaling pathway Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0000156 phosphorelay response regulator activity Molecular Function

KEGG gene cross-reference

ath:AT3G57040

dosa:Os11g0143300

dosa:Os12g0139400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.630

Rank 1 · TkA08G399070 · TK1151

Cytoplasm0.351

Rank 2 · TkA08G399070 · TK1151

Cell membrane0.109

Rank 3 · TkA08G399070 · TK1151

Endoplasmic reticulum0.056

Rank 4 · TkA08G399070 · TK1151

Plastid0.029

Rank 5 · TkA08G399070 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00072Response_reg13-136 aa

PF07710P53_tetramer87-101 aa

PF07710P53_tetramer122-130 aa

PF13864Enkurin142-181 aa

PF07710P53_tetramer148-156 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G399070	`PF00072`	Response_reg	13	136	1.3e-19	71.1
TkA08G399070	`PF07710`	P53_tetramer	87	101	0.8	9.9
TkA08G399070	`PF07710`	P53_tetramer	122	130	0.8	9.9
TkA08G399070	`PF13864`	Enkurin	142	181	0.35	12.1
TkA08G399070	`PF07710`	P53_tetramer	148	156	0.8	9.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`B8BLZ4`	Oryza sativa subsp. indica	sp\|B8BLZ4\|ORR10_ORYSI Two-component response regulator ORR10	69.300%	Swiss-Prot	Low
`Q2QXY3`	Oryza sativa subsp. japonica	sp\|Q2QXY3\|ORR10_ORYSJ Two-component response regulator ORR10	69.300%	Swiss-Prot	Low
`Q4GZK2`	Oryza sativa subsp. indica	sp\|Q4GZK2\|ORR9_ORYSI Two-component response regulator ORR9	74.000%	Swiss-Prot	Low
`Q2RAP3`	Oryza sativa subsp. japonica	sp\|Q2RAP3\|ORR9_ORYSJ Two-component response regulator ORR9	74.000%	Swiss-Prot	Low
`Q4GZK7`	Oryza sativa subsp. indica	sp\|Q4GZK7\|ORR4_ORYSI Two-component response regulator ORR4	69.700%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card