TkA08G341550 | RubberDandelionOmics

Gene overview

TkA08G341550

Reference: TK1151 Chr: Chr08 Coordinates: 87579377-87580989 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

991 bp · TkA08G341550|TK1151|cDNA

CATCCGAATAAAATGAAATTGTTATAGTACCTACATGTAGGAAATAATTTGTAGTTTGACGTGGGGCCTTGCCTTAGGGCACCGACGACAAAATATTTTCTCAGTCCAGCCCAAATTTATTGTCGTCTGAATCATCTCCAAATGAACTCAGAATGAATTGAAGAGTGCCATTGCAAGTTTGCAACGATCACCCACCAGCTATTTTCAGCCGACCATCGCGCGATTCACCAGGTTCTCATATGTAGTACGCTGATCTCCTG...

CDS

Download CDS FASTA

342 bp · TkA08G341550|TK1151|CDS

ATGGCAACTATTAGAAATCTGAAAATCAAGACAGCAGCATGCAAACGAATTGTGAAGGAGCTACACTCTTATGAGAAAGAAGTCGAGAGAGAGGCAGCCAAGACAGCTGACATGAAGGAAAAGGGTGCTGACCCTTATGATCTTAAACAACAGGAAAATGTGTTGGGCGAATCACGGATGATGATTCCTGATTGTCGCAAACGTTTGGAGTCTTCACTAGCTGACCTAAAAGGGATATTGGCTGAGTTGGAGGAATTGAA...

Protein

Download Protein FASTA

113 aa · TkA08G341550|TK1151|PROTEIN

MATIRNLKIKTAACKRIVKELHSYEKEVEREAAKTADMKEKGADPYDLKQQENVLGESRMMIPDCRKRLESSLADLKGILAELEELKQKEGPEVVEAESTVADVEKLFQTTEA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G341550`
TK1151 ID	TkA08G341550
OH-1004 ID	LXL04_025726
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G341550

Location Chr08:87579377-87580989 (+)

Description Similar to TFCA: Tubulin-folding cofactor A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g30410`	Tubulin-folding protein involved in the control of the alpha-/beta-tubulin monomer balance.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025726 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006457 protein folding Biological Process

GO:0007021 tubulin complex assembly Biological Process

GO:0007023 post-chaperonin tubulin folding pathway Biological Process

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005874 microtubule Cellular Component

GO:0015630 microtubule cytoskeleton Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0015631 tubulin binding Molecular Function

GO:0048487 beta-tubulin binding Molecular Function

KEGG gene cross-reference

ath:AT2G30410

hsa:6902

mmu:21371

rno:366995

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.734

Rank 1 · TkA08G341550 · TK1151

Nucleus0.328

Rank 2 · TkA08G341550 · TK1151

Mitochondrion0.116

Rank 3 · TkA08G341550 · TK1151

Endoplasmic reticulum0.094

Rank 4 · TkA08G341550 · TK1151

Cell membrane0.093

Rank 5 · TkA08G341550 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02970TBCA3-100 aa

PF28175T4SS_LegC2C73-106 aa

PF14182YgaB4-40 aa

PF03961FapA7-101 aa

PF30778SBP_bac_4HB15-44 aa

PF08286Spc2416-45 aa

PF06651DUF116347-69 aa

PF14182YgaB60-109 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G341550	`PF02970`	TBCA	3	100	2.2e-30	105.6
TkA08G341550	`PF28175`	T4SS_LegC2C7	3	106	0.081	12.5
TkA08G341550	`PF14182`	YgaB	4	40	0.98	10.5
TkA08G341550	`PF03961`	FapA	7	101	0.57	10.5
TkA08G341550	`PF30778`	SBP_bac_4HB	15	44	0.053	14.5
TkA08G341550	`PF08286`	Spc24	16	45	0.049	14.6
TkA08G341550	`PF06651`	DUF1163	47	69	0.046	14.5
TkA08G341550	`PF14182`	YgaB	60	109	0.98	10.5
TkA08G341550	`PF30778`	SBP_bac_4HB	61	108	0.053	14.5
TkA08G341550	`PF08286`	Spc24	67	101	0.049	14.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O04350`	Arabidopsis thaliana	sp\|O04350\|TBCA_ARATH Tubulin-folding cofactor A	83.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card