TkA08G275750 | RubberDandelionOmics

Gene overview

TkA08G275750

Reference: TK1151 Chr: Chr08 Coordinates: 71773296-71776050 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1144 bp · TkA08G275750|TK1151|cDNA

ATAGGCATGTCAAATGCTACAAACTCGTTTCAAGTTGCCGACACGGATCCAACACTTAAACAAACCCTCTTTTTCGCACATATACCTGGGAGTCCCAAGTCCTAACATCTCTCCGCGTCGATCTCCAAGATTTTCCGGCGAGATCTCTGTCGTGTCCGTGGGAAAATCTTCATCCTCTGATCGCAACGTTGCCGTCGATATATCTGCTGGTATTTCCTAATTAATTTCAAATAAAATGGCTCCAGTGTCGGCTCTAGCCA...

CDS

Download CDS FASTA

624 bp · TkA08G275750|TK1151|CDS

ATGGCTCCAGTGTCGGCTCTAGCCAAGTACAAGCTCGTGTTCTTAGGAGATCAATCAGTTGGAAAAACGAGCATCATTACTCGATTCATGTATGACAAGTTTGACAACACTTATCAGGCTACAATTGGTATTGATTTTTTATCCAAGACTATGTATCTTGAAGACCGAACAGTTCGTTTGCAGCTTTGGGACACAGCTGGACAAGAAAGGTTCAGGAGTCTCATTCCAAGTTATATTAGGGACTCCTCTGTTGCAGTTAT...

Protein

Download Protein FASTA

207 aa · TkA08G275750|TK1151|PROTEIN

MAPVSALAKYKLVFLGDQSVGKTSIITRFMYDKFDNTYQATIGIDFLSKTMYLEDRTVRLQLWDTAGQERFRSLIPSYIRDSSVAVIVFDVASRQSFLNTAKWIEEVRTERGSDVIIVLVGNKTDLVDKRQVSIEEGEAKAREYNVMFIETSAKAGFNIKALFRKIASALPGMETLSSTKQEDMVDVNLKSSNTSGSQQPQSGGCAC

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G275750`
TK1151 ID	TkA08G275750
OH-1004 ID	LXL04_033576
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G275750

Location Chr08:71773296-71776050 (+)

Description Similar to RABH1B: Ras-related protein RABH1b

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g44610`	Protein transport.	No verified direct reference in this release
`At5g10260`	Protein transport.	No verified direct reference in this release
`At2g22290`	Protein transport.	No verified direct reference in this release
`At4g39890`	Protein transport.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033576 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0001558 regulation of cell growth Biological Process

GO:0006886 intracellular protein transport Biological Process

GO:0006887 exocytosis Biological Process

GO:0006890 retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum Biological Process

GO:0006891 intra-Golgi vesicle-mediated transport Biological Process

GO:0015031 protein transport Biological Process

GO:0034067 protein localization to Golgi apparatus Biological Process

GO:0042147 retrograde transport, endosome to Golgi Biological Process

GO:0052324 plant-type cell wall cellulose biosynthetic process Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0000325 plant-type vacuole Cellular Component

GO:0002080 acrosomal membrane Cellular Component

KEGG gene cross-reference

ath:AT2G22290

ath:AT2G44610

ath:AT4G39890

ath:AT5G10260

pon:100172563

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.543

Rank 1 · TkA08G275750 · TK1151

Golgi apparatus0.458

Rank 2 · TkA08G275750 · TK1151

Lysosome / Vacuole0.151

Rank 3 · TkA08G275750 · TK1151

Cell membrane0.150

Rank 4 · TkA08G275750 · TK1151

Endoplasmic reticulum0.149

Rank 5 · TkA08G275750 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03193RsgA_GTPase6-30 aa

PF20720nSTAND38-40 aa

PF00025Arf9-167 aa

PF12775AAA_79-50 aa

PF00071Ras11-169 aa

PF08477Roc11-125 aa

PF09439SRPRB11-132 aa

PF04670Gtr1_RagA11-131 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G275750	`PF03193`	RsgA_GTPase	6	30	7.9e-05	23.3
TkA08G275750	`PF20720`	nSTAND3	8	40	0.12	12.8
TkA08G275750	`PF00025`	Arf	9	167	3e-15	56.9
TkA08G275750	`PF12775`	AAA_7	9	50	0.068	13.4
TkA08G275750	`PF00071`	Ras	11	169	1.2e-58	198.0
TkA08G275750	`PF08477`	Roc	11	125	1.5e-37	129.1
TkA08G275750	`PF09439`	SRPRB	11	132	1.3e-05	25.4
TkA08G275750	`PF04670`	Gtr1_RagA	11	131	1.7e-05	25.1
TkA08G275750	`PF01926`	MMR_HSR1	12	119	6.8e-05	23.7
TkA08G275750	`PF00350`	Dynamin_N	13	31	0.081	13.7
TkA08G275750	`PF03029`	ATP_bind_1	15	29	0.019	15.5
TkA08G275750	`PF00274`	Glycolytic	39	80	0.11	11.9
TkA08G275750	`PF03029`	ATP_bind_1	41	136	0.019	15.5
TkA08G275750	`PF00009`	GTP_EFTU	43	171	6.5e-08	33.1
TkA08G275750	`PF13676`	TIR_2	53	130	0.032	15.4
TkA08G275750	`PF00350`	Dynamin_N	70	119	0.081	13.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O80501`	Arabidopsis thaliana	sp\|O80501\|RAH1B_ARATH Ras-related protein RABH1b	93.300%	Swiss-Prot	High
`Q9LFT9`	Arabidopsis thaliana	sp\|Q9LFT9\|RAH1E_ARATH Ras-related protein RABH1e	88.900%	Swiss-Prot	High
`Q9SID8`	Arabidopsis thaliana	sp\|Q9SID8\|RAH1D_ARATH Ras-related protein RABH1d	83.600%	Swiss-Prot	High
`Q9SMR4`	Arabidopsis thaliana	sp\|Q9SMR4\|RAH1C_ARATH Ras-related protein RABH1c	80.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card