TkA08G265520 | RubberDandelionOmics

Gene overview

TkA08G265520

Reference: TK1151 Chr: Chr08 Coordinates: 69191048-69191567 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

445 bp · TkA08G265520|TK1151|cDNA

AAATACCTCATTTGTGACTCCCATTGTGACATCGATTGCAACATAGGGGTACAGATCAATCGTGAATCCGAGAATGAACAAGCTCCAAATCCAAATGGGGATGACGATAAGATAACTTTATCAGGGCTGCTGAATTTCGTGGATGGATTGTGGTCAAGCTGTGGAGATGAGCGGATCATTGTGTTCACCACGAATCACAAAGAGCGTTTGGATGCGGCATTGTTGAGGCCAGGTCGAATGGATGTGCAGGTGGAGATGTC...

CDS

Download CDS FASTA

408 bp · TkA08G265520|TK1151|CDS

AAATACCTCATTTGTGACTCCCATTGTGACATCGATTGCAACATAGGGGTACAGATCAATCGTGAATCCGAGAATGAACAAGCTCCAAATCCAAATGGGGATGACGATAAGATAACTTTATCAGGGCTGCTGAATTTCGTGGATGGATTGTGGTCAAGCTGTGGAGATGAGCGGATCATTGTGTTCACCACGAATCACAAAGAGCGTTTGGATGCGGCATTGTTGAGGCCAGGTCGAATGGATGTGCAGGTGGAGATGTC...

Protein

Download Protein FASTA

135 aa · TkA08G265520|TK1151|PROTEIN

KYLICDSHCDIDCNIGVQINRESENEQAPNPNGDDDKITLSGLLNFVDGLWSSCGDERIIVFTTNHKERLDAALLRPGRMDVQVEMSYCSYGGFKVLASTYLQVKEEEKMELFGEIEGLLKKVEVTPAQIAGLQD

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G265520`
TK1151 ID	TkA08G265520
OH-1004 ID	LXL04_030491
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	95.100
Protein coverage (%)	TK1151 91.111 / OH-1004 27.703 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G265520

Location Chr08:69191048-69191567 (+)

Description Similar to HSR4: Protein HYPER-SENSITIVITY-RELATED 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g28570`	AAA-ATPase At3g28570, mitochondrial.	No verified direct reference in this release
`At2g18193`	AAA-ATPase At2g18193.	No verified direct reference in this release
`At3g50930`	Protein HYPER-SENSITIVITY-RELATED 4.	No verified direct reference in this release
`At5g40000`	AAA-ATPase At5g40000.	No verified direct reference in this release
`At3g50940`	AAA-ATPase At3g50940.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030491 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002237 response to molecule of bacterial origin Biological Process

GO:0006950 response to stress Biological Process

GO:0009411 response to UV Biological Process

GO:0009617 response to bacterium Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009863 salicylic acid mediated signaling pathway Biological Process

GO:0012501 programmed cell death Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005740 mitochondrial envelope Cellular Component

GO:0005741 mitochondrial outer membrane Cellular Component

KEGG gene cross-reference

ath:AT2G18190

ath:AT2G18193

ath:AT3G50930

ath:AT3G50940

ath:AT5G17760

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.417

Rank 1 · TkA08G265520 · TK1151

Peroxisome0.186

Rank 2 · TkA08G265520 · TK1151

Mitochondrion0.177

Rank 3 · TkA08G265520 · TK1151

Nucleus0.165

Rank 4 · TkA08G265520 · TK1151

Endoplasmic reticulum0.095

Rank 5 · TkA08G265520 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00004AAA32-87 aa

PF25568AAA_lid_At3g2854089-131 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G265520	`PF00004`	AAA	32	87	1.3e-05	26.4
TkA08G265520	`PF25568`	AAA_lid_At3g28540	89	131	2.2e-12	47.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4J0B7`	Arabidopsis thaliana	sp\|F4J0B7\|AATP8_ARATH AAA-ATPase At3g28570, mitochondrial	50.800%	Swiss-Prot	High
`Q8GW96`	Arabidopsis thaliana	sp\|Q8GW96\|AATP3_ARATH AAA-ATPase At2g18193	59.800%	Swiss-Prot	High
`Q8VZG2`	Arabidopsis thaliana	sp\|Q8VZG2\|HSR4_ARATH Protein HYPER-SENSITIVITY-RELATED 4	54.700%	Swiss-Prot	High
`F4KFX5`	Arabidopsis thaliana	sp\|F4KFX5\|AATPJ_ARATH AAA-ATPase At5g40000	49.200%	Swiss-Prot	Medium
`Q147F9`	Arabidopsis thaliana	sp\|Q147F9\|AATPC_ARATH AAA-ATPase At3g50940	54.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card