TkA08G258010 | RubberDandelionOmics

Gene overview

TkA08G258010

Reference: TK1151 Chr: Chr08 Coordinates: 67264293-67266164 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

803 bp · TkA08G258010|TK1151|cDNA

ATAGGTGTCAACTAAAATGGCAATGTTATCAAGGGCCCGCGTACTTTCCTCAACTTTATTCTCCAAGCTGGCCCACCACCCTCCAATCCATCGCACCTTCAGCTCTCCATCAACACCCCGTGACAAGACCTCACTAATGATGGACAACAACCCGTTATTCTCACTGGACATAAGTTCCCAAACAGGAAGTTGCATGCCCATATCCATGATGCGGATCGGGACCATAATCCACAACATCGAAATGAACCCGGGTCAGGGAG...

CDS

Download CDS FASTA

843 bp · TkA08G258010|TK1151|CDS

CTTTTTTGGACCCTTACGCAAACCACGAGCAGGAGCAGCCCCAAACCTTCACTCCTAACTTCTCATCAGTGCTTGTTGCTGTCGATTTCTTTCTCGACGCCTCGTGAGTCGGTGACGGGTGACCGCCGACCTGTTTCTGAGCCTCCCGTTCTTCCTCCACGGTGTTCCACCTCTCTAGGGTTCGACTTCCTTCCAGGCTTCCACAGAACCGGCCCCAACCAGGTGTCAACTAAAATGGCAATGTTATCAAGGGCCCGCGT...

Protein

Download Protein FASTA

280 aa · TkA08G258010|TK1151|PROTEIN

LFWTLTQTTSRSSPKPSLLTSHQCLLLSISFSTPRESVTGDRRPVSEPPVLPPRCSTSLGFDFLPGFHRTGPNQVSTKMAMLSRARVLSSTLFSKLAHHPPIHRTFSSPSTPRDKTSLMMDNNPLFSLDISSQTGSCMPISMMRIGTIIHNIEMNPGQGGKLVRAAGTSAKILKEPSASKLCLIRLPSGVEKLVDSRCRATIGVVSNAEHATKKLRKAGQSRWLGRRPVVRGVAMNPVDHPHGGGEGKSKSSGCRGGVSR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G258010`
TK1151 ID	TkA08G258010
OH-1004 ID	LXL04_033458
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.300
Protein coverage (%)	TK1151 96.429 / OH-1004 67.164 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G258010

Location Chr08:67264293-67266164 (-)

Description Similar to RPL2: 60S ribosomal protein L2, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g44065`	Large ribosomal subunit protein uL2my, C-terminal part.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: P0C8K6`	Large ribosomal subunit protein uL2m.	No verified direct reference in this release
`UniProt: Q2F969`	Large ribosomal subunit protein uL2m.	No verified direct reference in this release
`UniProt: P92812`	Large ribosomal subunit protein uL2m.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033458 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006412 translation Biological Process

GO:0032543 mitochondrial translation Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005762 mitochondrial large ribosomal subunit Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0015934 large ribosomal subunit Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003735 structural constituent of ribosome Molecular Function

GO:0016740 transferase activity Molecular Function

KEGG gene cross-reference

ath:AT2G44065

dosa:rpl2

osa:6450181

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.483

Rank 1 · TkA08G258010 · TK1151

Mitochondrion0.413

Rank 2 · TkA08G258010 · TK1151

Cytoplasm0.113

Rank 3 · TkA08G258010 · TK1151

Nucleus0.060

Rank 4 · TkA08G258010 · TK1151

Peroxisome0.012

Rank 5 · TkA08G258010 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03947Ribosomal_L2_C134-252 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G258010	`PF03947`	Ribosomal_L2_C	134	252	1.1e-50	171.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VZU4`	Arabidopsis thaliana	sp\|Q8VZU4\|RM02C_ARATH Large ribosomal subunit protein uL2my, C-terminal part	61.200%	Swiss-Prot	High
`P0C8K6`	Oryza sativa	sp\|P0C8K6\|RM02_ORYSA Large ribosomal subunit protein uL2m	67.300%	Swiss-Prot	High
`Q2F969`	Oryza sativa subsp. indica	sp\|Q2F969\|RM02_ORYSI Large ribosomal subunit protein uL2m	67.300%	Swiss-Prot	High
`P92812`	Oryza sativa subsp. japonica	sp\|P92812\|RM02_ORYSJ Large ribosomal subunit protein uL2m	67.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card