TkA08G250200 | RubberDandelionOmics

Gene overview

TkA08G250200

Reference: TK1151 Chr: Chr08 Coordinates: 65356084-65359992 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3809 bp · TkA08G250200|TK1151|cDNA

AAAAAAGAGAGGTTTTTAGAGAGAGAAAGACACAGAGGAAGAAAGAGAGACGCAAAGATTAAGAAACAAACCTCAAATGATACAACAAACCCAAGAAAAGTTTGCAATTTGAGGCAAATGTCGACGTTGTCTTGCCCTAAATCCCATAACCATTATCTTATTAATCTCCATTGTTTCTTGAAATCACCTCTGTTTTTCCTCTTCGTTTCTATAAATCTTTTCTTAATTTTCTGTTCCGCGGCCGCCGCCGTTGCCGGCGG...

CDS

Download CDS FASTA

3504 bp · TkA08G250200|TK1151|CDS

AAAAAAGAGAGGTTTTTAGAGAGAGAAAGACACAGAGGAAGAAAGAGAGACGCAAAGATTAAGAAACAAACCTCAAATGATACAACAAACCCAAGAAAAGTTTGCAATTTGAGGCAAATGTCGACGTTGTCTTGCCCTAAATCCCATAACCATTATCTTATTAATCTCCATTGTTTCTTGAAATCACCTCTGTTTTTCCTCTTCGTTTCTATAAATCTTTTCTTAATTTTCTGTTCCGCGGCCGCCGCCGTTGCCGGCGG...

Protein

Download Protein FASTA

1167 aa · TkA08G250200|TK1151|PROTEIN

KKERFLERERHRGRKRDAKIKKQTSNDTTNPRKVCNLRQMSTLSCPKSHNHYLINLHCFLKSPLFFLFVSINLFLIFCSAAAAVAGGGGGYNHEAILLSTWVHGGNVGGSFFSSWTLSGNSKTPCKWDYIKCDSQGFVSEIYIQSIPLQLPLPTNLSSFSHLKSLTISDANITGTLSDDLGGCRELVAIDLSSNSLVGPIPSSIGSLENLQDLILNSNKLTGKIPRELGNCRSLKNLHLFDNRLTGNIPPELGQLQSLEV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G250200`
TK1151 ID	TkA08G250200
OH-1004 ID	LXL04_033311
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 99.229 / OH-1004 91.759 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G250200

Location Chr08:65356084-65359992 (+)

Description Similar to RCH2: Receptor-like protein kinase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g24240`	Together with RGI2, RGI3, RGI4 and RGI5, acts as a receptor of RGF peptides (e.g. RGF1, GLV5/CLEL1/RGF2, GLV7/CLEL3/RGF3, GLV3/RGF4, GLV10/CLEL7/RGF5 and RGF10/CLELN), peptide hormones which maintain the postembryonic root stem cell niche by regulating the expression levels and patterns of the transcription factor PLETHORA (PLT, e.g. PLT1 and PLT2).	RGF1 INSENSITIVE 1 to 5, a group of LRR receptor-like kinases, are essential for the perception of root meristem growth factor 1 in Arabidopsis thaliana.2016 · DOI: 10.1038/cr.2016.63
`At5g48940`	Together with RGI1, RGI3, RGI4 and RGI5, acts as a receptor of RGF peptides (e.g. RGF1, GLV5/CLEL1/RGF2, GLV7/CLEL3/RGF3, GLV3/RGF4, GLV10/CLEL7/RGF5 and RGF10/CLELN), peptide hormones which maintain the postembryonic root stem cell niche by regulating the expression levels and patterns of the transcription factor PLETHORA (PLT, e.g. PLT1 and PLT2).	RGF1 INSENSITIVE 1 to 5, a group of LRR receptor-like kinases, are essential for the perception of root meristem growth factor 1 in Arabidopsis thaliana.2016 · DOI: 10.1038/cr.2016.63
`At1g34110`	Together with RGI1, RGI2, RGI3 and RGI4, acts as a receptor of RGF1, a peptide hormone that maintains the postembryonic root stem cell niche by regulating the expression levels and patterns of the transcription factor PLETHORA (PLT).	RGF1 INSENSITIVE 1 to 5, a group of LRR receptor-like kinases, are essential for the perception of root meristem growth factor 1 in Arabidopsis thaliana.2016 · DOI: 10.1038/cr.2016.63
`At5g56040`	Receptor with a serine/threonine-protein kinase activity (By similarity).	A novel pollen-pistil interaction conferring high-temperature tolerance during reproduction via CLE45 signaling.2013 · DOI: 10.1016/j.cub.2013.06.060 RGF1 INSENSITIVE 1 to 5, a group of LRR receptor-like kinases, are essential for the perception of root meristem growth factor 1 in Arabidopsis thaliana.2016 · DOI: 10.1038/cr.2016.63 Arabidopsis MAKR5 is a positive effector of BAM3-dependent CLE45 signaling.2016 · DOI: 10.15252/embr.201642450
`At4g26540`	May act as an RGF peptide receptor regulating root meristem growth.	RGF1 INSENSITIVE 1 to 5, a group of LRR receptor-like kinases, are essential for the perception of root meristem growth factor 1 in Arabidopsis thaliana.2016 · DOI: 10.1038/cr.2016.63

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033311 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009266 response to temperature stimulus Biological Process

GO:0009755 hormone-mediated signaling pathway Biological Process

GO:0010074 maintenance of meristem identity Biological Process

GO:0010078 maintenance of root meristem identity Biological Process

GO:0010082 regulation of root meristem growth Biological Process

GO:0010449 root meristem growth Biological Process

GO:0080092 regulation of pollen tube growth Biological Process

GO:2000280 regulation of root development Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0001653 peptide receptor activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G34110

ath:AT3G24240

ath:AT4G26540

ath:AT5G48940

ath:AT5G56040

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.869

Rank 1 · TkA08G250200 · TK1151

Endoplasmic reticulum0.089

Rank 2 · TkA08G250200 · TK1151

Cytoplasm0.060

Rank 3 · TkA08G250200 · TK1151

Nucleus0.044

Rank 4 · TkA08G250200 · TK1151

Lysosome / Vacuole0.026

Rank 5 · TkA08G250200 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08263LRRNT_2109-133 aa

PF24141LRR_ComC144-206 aa

PF24758LRR_At5g56370149-177 aa

PF23598LRR_14155-262 aa

PF13855LRR_8156-196 aa

PF29252LRR_NLRC4157-241 aa

PF00560LRR_1161-183 aa

PF12799LRR_4161-200 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G250200	`PF08263`	LRRNT_2	109	133	0.033	15.2
TkA08G250200	`PF24141`	LRR_ComC	144	206	2.3e-07	31.5
TkA08G250200	`PF24758`	LRR_At5g56370	149	177	1.9e-06	28.4
TkA08G250200	`PF23598`	LRR_14	155	262	2.6e-46	158.7
TkA08G250200	`PF13855`	LRR_8	156	196	4.2e-41	139.2
TkA08G250200	`PF29252`	LRR_NLRC4	157	241	0.0014	18.6
TkA08G250200	`PF00560`	LRR_1	161	183	2e-56	176.4
TkA08G250200	`PF12799`	LRR_4	161	200	9.9e-40	134.4
TkA08G250200	`PF29594`	LRR_SKP2	165	217	0.11	12.5
TkA08G250200	`PF23286`	LRR_13	175	209	0.0036	17.8
TkA08G250200	`PF13855`	LRR_8	185	244	4.2e-41	139.2
TkA08G250200	`PF00560`	LRR_1	186	207	2e-56	176.4
TkA08G250200	`PF24758`	LRR_At5g56370	207	258	1.9e-06	28.4
TkA08G250200	`PF00560`	LRR_1	209	231	2e-56	176.4
TkA08G250200	`PF12799`	LRR_4	209	244	9.9e-40	134.4
TkA08G250200	`PF25372`	LRR_FBXL15	231	314	0.0035	16.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LHP4`	Arabidopsis thaliana	sp\|Q9LHP4\|RGI1_ARATH LRR receptor-like serine/threonine-protein kinase RGI1	71.400%	Swiss-Prot	Low
`C0LGV1`	Arabidopsis thaliana	sp\|C0LGV1\|RGI2_ARATH LRR receptor-like serine/threonine-protein kinase RGI2	67.900%	Swiss-Prot	Low
`C0LGF5`	Arabidopsis thaliana	sp\|C0LGF5\|RGI5_ARATH LRR receptor-like serine/threonine-protein kinase RGI5	44.500%	Swiss-Prot	Low
`F4K6B8`	Arabidopsis thaliana	sp\|F4K6B8\|RGI4_ARATH Leucine-rich repeat receptor-like serine/threonine-protein kinase RGI4	43.300%	Swiss-Prot	Low
`C0LGR3`	Arabidopsis thaliana	sp\|C0LGR3\|RGI3_ARATH LRR receptor-like serine/threonine-protein kinase RGI3	44.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card