TkA08G239730 | RubberDandelionOmics

Gene overview

TkA08G239730

Reference: TK1151 Chr: Chr08 Coordinates: 62453914-62461421 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1765 bp · TkA08G239730|TK1151|cDNA

CTGAACTACAGCTCATTTGAATATTATTCATTTACGTCCCTGATTTTTTGCCTATAATATCATTTTCTTGCCAGTTACATCTCCTCAATTTAGGGAAGAATTCAATTTGGTCTCTCGCTCATTTGAATTACTTCAAAAGACGAATATCTATCTATTGCAGGTTTCTATTTTAGCTACAATCACGGCTATTCCAAATCACTCTTCTTATTTAATCTCAACTCCAAAATCCCCAATTGATCCACAACATCCTCAAATCCACC...

CDS

Download CDS FASTA

2064 bp · TkA08G239730|TK1151|CDS

ATGAAAGATCTCTTCCCTTTTGATCTAAACAAGGTACCTGCAGAAGAGAATTTGATGAATGGTCAACATGAAAAAGTTGCTATTGAAGAAGAAAGTCAAAACAAGAACTCAGTTTTTGAAGAACCCTTTGTTGGTCAATGTTTTCTAAGTGAAGAAGAAGCTTTTGCTTTTTATCAAAGTTATGCAAGAAAAAATGGGTTTTCTGTTCGAAAAGGAAGGTTCGTGAACAAGAAAACCGGAGAAAAGAAAAGACGTGATTT...

Protein

Download Protein FASTA

687 aa · TkA08G239730|TK1151|PROTEIN

MKDLFPFDLNKVPAEENLMNGQHEKVAIEEESQNKNSVFEEPFVGQCFLSEEEAFAFYQSYARKNGFSVRKGRFVNKKTGEKKRRDFFCHREGKPVFTKDYTKKTRNRGYTKCECKSHMRITLKRINEIFPEEWQVTKFVTEHNHALLSTQEVRFLPSYRNITLEDEKRILLLKEASLSVTQIMRVIELERNVKHGELSFLKKDIHNLFAKNHKLHSRNDAKELLEYCKSAKDDNLNFQYEFTLDSENRLEHIFWCPAHC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G239730`
TK1151 ID	TkA08G239730
OH-1004 ID	LXL04_021934
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	77.800
Protein coverage (%)	TK1151 99.854 / OH-1004 96.120 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G239730

Location Chr08:62453914-62461421 (+)

Description Similar to FRS11: Protein FAR1-RELATED SEQUENCE 11

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g10240`	Putative transcription activator involved in regulating light control of development.	No verified direct reference in this release
`At5g28530`	Putative protein FAR1-RELATED SEQUENCE 10.	No verified direct reference in this release
`At4g38180`	Putative transcription activator involved in regulating light control of development.	No verified direct reference in this release
`At4g15090`	Transcription activator that recognizes and binds to the DNA consensus sequence 5'-CACGCGC-3'.	No verified direct reference in this release
`At3g06250`	Putative transcription activator involved in regulating light control of development.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021934 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0005634 nucleus Cellular Component

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G10240

ath:AT4G38180

ath:AT5G28530

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.934

Rank 1 · TkA08G239730 · TK1151

Cytoplasm0.127

Rank 2 · TkA08G239730 · TK1151

Mitochondrion0.027

Rank 3 · TkA08G239730 · TK1151

Cell membrane0.019

Rank 4 · TkA08G239730 · TK1151

Endoplasmic reticulum0.010

Rank 5 · TkA08G239730 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03101FAR157-148 aa

PF00039fn1104-117 aa

PF02406MmoB_DmpM105-139 aa

PF26175HTH_FAR1161-215 aa

PF21056ZSWIM1-3_RNaseH-like240-347 aa

PF10551MULE270-362 aa

PF00872Transposase_mut282-416 aa

PF21056ZSWIM1-3_RNaseH-like514-533 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G239730	`PF03101`	FAR1	57	148	3.1e-18	67.0
TkA08G239730	`PF00039`	fn1	104	117	4.0	8.4
TkA08G239730	`PF02406`	MmoB_DmpM	105	139	0.24	12.3
TkA08G239730	`PF26175`	HTH_FAR1	161	215	5.2e-22	78.1
TkA08G239730	`PF21056`	ZSWIM1-3_RNaseH-like	240	347	1.5e-11	45.1
TkA08G239730	`PF10551`	MULE	270	362	1.8e-24	86.6
TkA08G239730	`PF00872`	Transposase_mut	282	416	0.007	16.0
TkA08G239730	`PF21056`	ZSWIM1-3_RNaseH-like	514	533	1.5e-11	45.1
TkA08G239730	`PF00039`	fn1	543	559	4.0	8.4
TkA08G239730	`PF04434`	SWIM	545	578	1.6e-08	34.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SY66`	Arabidopsis thaliana	sp\|Q9SY66\|FRS11_ARATH Protein FAR1-RELATED SEQUENCE 11	39.700%	Swiss-Prot	Medium
`Q9LKR4`	Arabidopsis thaliana	sp\|Q9LKR4\|FRS10_ARATH Putative protein FAR1-RELATED SEQUENCE 10	35.300%	Swiss-Prot	Medium
`Q9SZL8`	Arabidopsis thaliana	sp\|Q9SZL8\|FRS5_ARATH Protein FAR1-RELATED SEQUENCE 5	31.900%	Swiss-Prot	Medium
`Q9SWG3`	Arabidopsis thaliana	sp\|Q9SWG3\|FAR1_ARATH Protein FAR-RED IMPAIRED RESPONSE 1	30.000%	Swiss-Prot	Medium
`Q9M8J3`	Arabidopsis thaliana	sp\|Q9M8J3\|FRS7_ARATH Protein FAR1-RELATED SEQUENCE 7	29.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card