TkA08G213150 | RubberDandelionOmics

Gene overview

TkA08G213150

Reference: TK1151 Chr: Chr08 Coordinates: 55769984-55772233 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1936 bp · TkA08G213150|TK1151|cDNA

ATGAAATTTCTTGATCTATGCTTGATTTTAGCCACCATCACCTCAACCTCTATTCCCACCACCACCGCATGGACCAATGCCCATGCCACCTTTTACGGAGGTCACGACGCCTCCGGTACAATGGGTGGAGCATGTGGATACGGAAATCTTTACAGTCAGGGATACGGTACAACCACTGCTGCAGTAAGTACCGCTCTCTTCAAGAACGGTCTTGCATGTGGGGCTTGTTTCGAGATCAAGTGTTTTAACGACCAAAAATG...

CDS

Download CDS FASTA

705 bp · TkA08G213150|TK1151|CDS

ATGAAATTTCTTGATCTATGCTTGATTTTAGCCACCATCACCTCAACCTCTATTCCCACCACCACCGCATGGACCAATGCCCATGCCACCTTTTACGGAGGTCACGACGCCTCCGGTACAATGGGTGGAGCATGTGGATACGGAAATCTTTACAGTCAGGGATACGGTACAACCACTGCTGCAGTAAGTACCGCTCTCTTCAAGAACGGTCTTGCATGTGGGGCTTGTTTCGAGATCAAGTGTTTTAACGACCAAAAATG...

Protein

Download Protein FASTA

234 aa · TkA08G213150|TK1151|PROTEIN

MKFLDLCLILATITSTSIPTTTAWTNAHATFYGGHDASGTMGGACGYGNLYSQGYGTTTAAVSTALFKNGLACGACFEIKCFNDQKWCLPGSIIVTATNFCPSNSNAHFDLAQPIFKHIAQEKAGMIPVQYRRAPCRKSGGMRFTINGHSFFNLVLVTNVGGAGDVIRVSVKGSKGATWQAMSRNWGQNWQSNGYLNGQSLSFKVTTSDGRSVISHKVAPRNWSFGQTYTGRQF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G213150`
TK1151 ID	TkA08G213150
OH-1004 ID	LXL04_032915
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 83.571 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G213150

Location Chr08:55769984-55772233 (-)

Description Similar to EXPA15: Expansin-A15

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g26770`	Causes loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release
`At2g03090`	Causes loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release
`At1g69530`	Causes loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release
`At5g56320`	Causes loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	LBD18 acts as a transcriptional activator that directly binds to the EXPANSIN14 promoter in promoting lateral root emergence of Arabidopsis.2013 · DOI: 10.1111/tpj.12013
`At2g40610`	Causes loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032915 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006949 syncytium formation Biological Process

GO:0009635 response to herbicide Biological Process

GO:0009739 response to gibberellin Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0009828 plant-type cell wall loosening Biological Process

GO:0009831 plant-type cell wall modification involved in multidimensional cell growth Biological Process

GO:0010114 response to red light Biological Process

GO:0010119 regulation of stomatal movement Biological Process

GO:0010311 lateral root formation Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009505 plant-type cell wall Cellular Component

KEGG gene cross-reference

ath:AT1G26770

ath:AT1G69530

ath:AT2G03090

ath:AT2G40610

ath:AT5G56320

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.768

Rank 1 · TkA08G213150 · TK1151

Cytoplasm0.086

Rank 2 · TkA08G213150 · TK1151

Lysosome / Vacuole0.053

Rank 3 · TkA08G213150 · TK1151

Endoplasmic reticulum0.039

Rank 4 · TkA08G213150 · TK1151

Cell membrane0.025

Rank 5 · TkA08G213150 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29515Expansin_N6-123 aa

PF22514EXPB1_D128-107 aa

PF03330DPBB_159-131 aa

PF22514EXPB1_D1105-138 aa

PF01357Expansin_C142-220 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G213150	`PF29515`	Expansin_N	6	123	7.5e-11	43.0
TkA08G213150	`PF22514`	EXPB1_D1	28	107	4.5e-07	31.0
TkA08G213150	`PF03330`	DPBB_1	59	131	5.9e-23	81.6
TkA08G213150	`PF22514`	EXPB1_D1	105	138	4.5e-07	31.0
TkA08G213150	`PF01357`	Expansin_C	142	220	2.8e-30	105.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LDR9`	Arabidopsis thaliana	sp\|Q9LDR9\|EXP10_ARATH Expansin-A10	71.900%	Swiss-Prot	High
`O80622`	Arabidopsis thaliana	sp\|O80622\|EXP15_ARATH Expansin-A15	73.200%	Swiss-Prot	High
`Q9C554`	Arabidopsis thaliana	sp\|Q9C554\|EXPA1_ARATH Expansin-A1	72.600%	Swiss-Prot	High
`Q9FMA0`	Arabidopsis thaliana	sp\|Q9FMA0\|EXP14_ARATH Expansin-A14	71.400%	Swiss-Prot	High
`O22874`	Arabidopsis thaliana	sp\|O22874\|EXPA8_ARATH Expansin-A8	68.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card