TkA08G209600 | RubberDandelionOmics

Gene overview

TkA08G209600

Reference: TK1151 Chr: Chr08 Coordinates: 54789594-54790748 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

957 bp · TkA08G209600|TK1151|cDNA

TCTCTCTCTCTCTATCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCAAAAAGAATGACAAGCTCTACAAGAAGGCTGGAAGGTAAGGTAGCATTGATCACCGGAGCAGCAAGCGGTATCGGCGAATGTACCGCAAAGCTCTTTGCGGAACACGGAGCAAAAGTCGTCATTGCAGACATCCAAGACCAACTTGGTCAAGCAGTGTGTGAGACCATAGGCACATCAAACTCAACATACGTCCATTGCGATGTAACCAATGAA...

CDS

Download CDS FASTA

813 bp · TkA08G209600|TK1151|CDS

ATGACAAGCTCTACAAGAAGGCTGGAAGGTAAGGTAGCATTGATCACCGGAGCAGCAAGCGGTATCGGCGAATGTACCGCAAAGCTCTTTGCGGAACACGGAGCAAAAGTCGTCATTGCAGACATCCAAGACCAACTTGGTCAAGCAGTGTGTGAGACCATAGGCACATCAAACTCAACATACGTCCATTGCGATGTAACCAATGAAGAAGATGTGAAAAAAGCTGTAGATACTGCAGTCGCCACTTACGGACAACTCGA...

Protein

Download Protein FASTA

270 aa · TkA08G209600|TK1151|PROTEIN

MTSSTRRLEGKVALITGAASGIGECTAKLFAEHGAKVVIADIQDQLGQAVCETIGTSNSTYVHCDVTNEEDVKKAVDTAVATYGQLDIMFCNAGIADPNKPRIVDNEKTDFERVLSVNITGVFLSMKHAARVMVPARSGSIISTASLSSNIGGAASHAYCCAKHAVAGLTKNLAVELGQFGIRVNCLSPYAMVTPLATSFVGLEGEALETVMNLLGNLKGPTLRTDDVAKAALFLVSEDAQYISGQNLFVDGGFGIVNPS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G209600`
TK1151 ID	TkA08G209600
OH-1004 ID	LXL04_032855
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G209600

Location Chr08:54789594-54790748 (-)

Description Similar to Secoisolariciresinol dehydrogenase (Fragment)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0179200`	Involved in momilactone phytoalexins biosynthesis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032855 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009807 lignan biosynthetic process Biological Process

GO:0016114 terpenoid biosynthetic process Biological Process

GO:0004022 alcohol dehydrogenase (NAD+) activity Molecular Function

GO:0016491 oxidoreductase activity Molecular Function

GO:0102960 momilactone-A synthase [NAD(P)H] activity Molecular Function

GO:0120529 secoisolariciresinol dehydrogenase activity Molecular Function

KEGG gene cross-reference

dosa:Os04g0179200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.574

Rank 1 · TkA08G209600 · TK1151

Peroxisome0.236

Rank 2 · TkA08G209600 · TK1151

Nucleus0.188

Rank 3 · TkA08G209600 · TK1151

Mitochondrion0.136

Rank 4 · TkA08G209600 · TK1151

Plastid0.058

Rank 5 · TkA08G209600 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00106adh_short11-199 aa

PF16763Spidroin_N12-63 aa

PF05368NmrA12-83 aa

PF08659KR13-171 aa

PF01370Epimerase13-191 aa

PF03435Sacchrp_dh_NADP14-76 aa

PF010733Beta_HSD14-79 aa

PF16363GDP_Man_Dehyd14-78 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G209600	`PF00106`	adh_short	11	199	9.4e-51	172.8
TkA08G209600	`PF16763`	Spidroin_N	12	63	0.02	15.7
TkA08G209600	`PF05368`	NmrA	12	83	0.054	13.8
TkA08G209600	`PF08659`	KR	13	171	8.6e-10	39.5
TkA08G209600	`PF01370`	Epimerase	13	191	0.00031	21.0
TkA08G209600	`PF03435`	Sacchrp_dh_NADP	14	76	0.0023	19.0
TkA08G209600	`PF01073`	3Beta_HSD	14	79	0.021	14.6
TkA08G209600	`PF16363`	GDP_Man_Dehyd	14	78	0.23	11.6
TkA08G209600	`PF13561`	adh_short_C2	17	254	2.2e-65	221.3
TkA08G209600	`PF02737`	3HCDH_N	22	78	0.025	15.2
TkA08G209600	`PF16363`	GDP_Man_Dehyd	158	210	0.23	11.6
TkA08G209600	`PF03435`	Sacchrp_dh_NADP	173	190	0.0023	19.0
TkA08G209600	`PF05368`	NmrA	219	246	0.054	13.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q7FAE1`	Oryza sativa subsp. japonica	sp\|Q7FAE1\|MOMAS_ORYSJ Momilactone A synthase	59.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card