TkA08G203620 | RubberDandelionOmics

Gene overview

TkA08G203620

Reference: TK1151 Chr: Chr08 Coordinates: 53248199-53251965 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1235 bp · TkA08G203620|TK1151|cDNA

CGAATTGTTGCAAACTTTGTGAGTGGGTTTAGCTGATATGGAAAACGTGTGAAGAAGCCCCTGTCGAATTTTCTGAACCCCGATCGGTTGGACTGCGATTATCTCAGTGAAGGCCATGACGATGTACTCCGACAACTCTTCTTCGATCGTTCGTCTCAATATAGGGGGGAAGAAATTCTGCACAACTGCTGATACTCTAACTCAGCGTGAGCCTTATTCAATGCTTGCTGCAATGTTCAGTGGTCGCCATACTGTTTGCA...

CDS

Download CDS FASTA

909 bp · TkA08G203620|TK1151|CDS

ATGACGATGTACTCCGACAACTCTTCTTCGATCGTTCGTCTCAATATAGGGGGGAAGAAATTCTGCACAACTGCTGATACTCTAACTCAGCGTGAGCCTTATTCAATGCTTGCTGCAATGTTCAGTGGTCGCCATACTGTTTGCAAGGACTCTGAGAAGGGATATGTATTTGTTGATAGAGACGGGAAACACTTTAGACATGTTTTAAATTGGCTGAGAGATGGTGTAGTTCCTAATTTGTCAGATTTAGAATGCTCAGA...

Protein

Download Protein FASTA

302 aa · TkA08G203620|TK1151|PROTEIN

MTMYSDNSSSIVRLNIGGKKFCTTADTLTQREPYSMLAAMFSGRHTVCKDSEKGYVFVDRDGKHFRHVLNWLRDGVVPNLSDLECSELLREAEYYQLLGLVDGITEVLNKRKEDEEMDTELTRTDIIKCIQSEKVRLRGVNLSGLDLSKLDLSFVDFSYACLKNVFFSRANLQCAKFRDVDAENTIFHNATLRECEFTGANLRGALLAGANLQSANLQDACLVDCSFCGADLRSAHLQTADLTNANLEGANLEGANLKGA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G203620`
TK1151 ID	TkA08G203620
OH-1004 ID	LXL04_032771
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 66.556 / OH-1004 63.208 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G203620

Location Chr08:53248199-53251965 (+)

Description Similar to FIP2: FH protein interacting protein FIP2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g55000`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032771 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002347 response to tumor cell Biological Process

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0009615 response to virus Biological Process

GO:0010467 gene expression Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0035024 negative regulation of Rho protein signal transduction Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0045746 negative regulation of Notch signaling pathway Biological Process

GO:0048469 cell maturation Biological Process

GO:0051260 protein homooligomerization Biological Process

GO:0005576 extracellular region Cellular Component

KEGG gene cross-reference

ath:AT5G55000

hsa:54793

hsa:83892

mmu:105440

rno:494521

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.703

Rank 1 · TkA08G203620 · TK1151

Cytoplasm0.309

Rank 2 · TkA08G203620 · TK1151

Mitochondrion0.060

Rank 3 · TkA08G203620 · TK1151

Cell membrane0.029

Rank 4 · TkA08G203620 · TK1151

Endoplasmic reticulum0.017

Rank 5 · TkA08G203620 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02214BTB_212-100 aa

PF16017BTB_314-95 aa

PF23099UTP20_C75-156 aa

PF13599Pentapeptide_4134-205 aa

PF00805Pentapeptide135-168 aa

PF00805Pentapeptide151-189 aa

PF25296Decapeptide155-205 aa

PF23894LD_SV2157-210 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G203620	`PF02214`	BTB_2	12	100	8.9e-20	71.6
TkA08G203620	`PF16017`	BTB_3	14	95	0.0022	18.6
TkA08G203620	`PF23099`	UTP20_C	75	156	0.13	12.3
TkA08G203620	`PF13599`	Pentapeptide_4	134	205	2e-23	82.9
TkA08G203620	`PF00805`	Pentapeptide	135	168	2.3e-45	152.4
TkA08G203620	`PF00805`	Pentapeptide	151	189	2.3e-45	152.4
TkA08G203620	`PF25296`	Decapeptide	155	205	4e-05	24.1
TkA08G203620	`PF23894`	LD_SV2	157	210	0.00028	21.9
TkA08G203620	`PF00805`	Pentapeptide	170	207	2.3e-45	152.4
TkA08G203620	`PF13576`	Pentapeptide_3	175	214	3.1e-14	53.6
TkA08G203620	`PF13576`	Pentapeptide_3	187	227	3.1e-14	53.6
TkA08G203620	`PF26602`	HVO_2718_N	198	213	0.5	10.6
TkA08G203620	`PF13599`	Pentapeptide_4	207	272	2e-23	82.9
TkA08G203620	`PF00805`	Pentapeptide	210	249	2.3e-45	152.4
TkA08G203620	`PF23894`	LD_SV2	212	255	0.00028	21.9
TkA08G203620	`PF21344`	Zn_ribbon_LysW	212	236	0.13	12.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SE95`	Arabidopsis thaliana	sp\|Q9SE95\|FIP2_ARATH FH protein interacting protein FIP2	76.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card