TkA08G203340 | RubberDandelionOmics

Gene overview

TkA08G203340

Reference: TK1151 Chr: Chr08 Coordinates: 53152468-53162133 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1758 bp · TkA08G203340|TK1151|cDNA

ATGTCTAGAGTTGGTACTAAGCTCAGCAAACTTGAACGATTTCTGGTCTGTCCTTGGTTCCTTGCTGCTTTTCCGTCCGCTGTTGTCACTGCCAACCTGCGTGAGCTTTCCGATCACAGTCCGGTTTCCCTTATCTCCTCTTCAGTTGAATTTAGTTCCCCGCCATTTAAATTCTTCAACTCATTGTTGCTGAACAAAGACATTGATCAGGTTGTGACCGAAGCTTGTTCTAGTTTTCGGGGACACGGGCTGCCAGACAA...

CDS

Download CDS FASTA

1758 bp · TkA08G203340|TK1151|CDS

ATGTCTAGAGTTGGTACTAAGCTCAGCAAACTTGAACGATTTCTGGTCTGTCCTTGGTTCCTTGCTGCTTTTCCGTCCGCTGTTGTCACTGCCAACCTGCGTGAGCTTTCCGATCACAGTCCGGTTTCCCTTATCTCCTCTTCAGTTGAATTTAGTTCCCCGCCATTTAAATTCTTCAACTCATTGTTGCTGAACAAAGACATTGATCAGGTTGTGACCGAAGCTTGTTCTAGTTTTCGGGGACACGGGCTGCCAGACAA...

Protein

Download Protein FASTA

585 aa · TkA08G203340|TK1151|PROTEIN

MSRVGTKLSKLERFLVCPWFLAAFPSAVVTANLRELSDHSPVSLISSSVEFSSPPFKFFNSLLLNKDIDQVVTEACSSFRGHGLPDKYFVAKLRYIKNRLKNWRSEETKKEKQEIDSVKSKVADLEKIAETRILNDQEQNEYSNGMHKIMEIQKITVLDLKQKARIRWTIDGDENTKFFHGHINCKNRKNRINGLLINGRWTSEKTEIKNEAHRFFGEFFWETHINRPPLISHHFKSIPMMDAIRLEAPFTIDEGIRMSD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G203340`
TK1151 ID	TkA08G203340
OH-1004 ID	LXL04_021085
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	29.400
Protein coverage (%)	TK1151 98.632 / OH-1004 33.376 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G203340`
Location	Chr08:53152468-53162133 (+)
Description	Similar to RE1: Retrovirus-related Pol polyprotein from transposon RE1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_021085` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006310 DNA recombination Biological Process GO:0006508 proteolysis Biological Process GO:0015074 DNA integration Biological Process GO:0003676 nucleic acid binding Molecular Function GO:0003964 RNA-directed DNA polymerase activity Molecular Function GO:0004190 aspartic-type endopeptidase activity Molecular Function GO:0004519 endonuclease activity Molecular Function GO:0008270 zinc ion binding Molecular Function
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.658

Rank 1 · TkA08G203340 · TK1151

Nucleus0.317

Rank 2 · TkA08G203340 · TK1151

Cell membrane0.091

Rank 3 · TkA08G203340 · TK1151

Endoplasmic reticulum0.035

Rank 4 · TkA08G203340 · TK1151

Lysosome / Vacuole0.034

Rank 5 · TkA08G203340 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00078RVT_183-143 aa

PF16752TBCC_N88-130 aa

PF28337NNF2_middle91-123 aa

PF13995YebF94-108 aa

PF13995YebF145-189 aa

PF00078RVT_1253-340 aa

PF28337NNF2_middle355-363 aa

PF28337NNF2_middle438-452 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G203340	`PF00078`	RVT_1	83	143	0.00011	22.9
TkA08G203340	`PF16752`	TBCC_N	88	130	0.046	14.7
TkA08G203340	`PF28337`	NNF2_middle	91	123	5.2	7.5
TkA08G203340	`PF13995`	YebF	94	108	0.092	13.5
TkA08G203340	`PF13995`	YebF	145	189	0.092	13.5
TkA08G203340	`PF00078`	RVT_1	253	340	0.00011	22.9
TkA08G203340	`PF28337`	NNF2_middle	355	363	5.2	7.5
TkA08G203340	`PF28337`	NNF2_middle	438	452	5.2	7.5
TkA08G203340	`PF13966`	zf-RVT	451	518	6.5e-13	49.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card