TkA08G202300 | RubberDandelionOmics

Gene overview

TkA08G202300

Reference: TK1151 Chr: Chr08 Coordinates: 52918784-52920461 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1359 bp · TkA08G202300|TK1151|cDNA

ATGATGAATTTGAGCTCCCGCAAAGTGATGTGCAAACGGCAGAAGCAGTCATCTGCATGCGACGAAATCAAAGAAGGAGAAGACTTCATAAGCAAATTACCGAATGCACTGCTCATAGTAATCCTCTCATTTCTCCCTGAAGCTGATGCCGTTCGGACATGCATCTTGTCGAACAGGTGGAAATACATCTGGGCGTTTCTCCCAAATCTGAGTCTCGTTATGCCTTTTTGTTGGTCGACTGAAGAAGCCAACCAATTTCA...

CDS

Download CDS FASTA

1359 bp · TkA08G202300|TK1151|CDS

ATGATGAATTTGAGCTCCCGCAAAGTGATGTGCAAACGGCAGAAGCAGTCATCTGCATGCGACGAAATCAAAGAAGGAGAAGACTTCATAAGCAAATTACCGAATGCACTGCTCATAGTAATCCTCTCATTTCTCCCTGAAGCTGATGCCGTTCGGACATGCATCTTGTCGAACAGGTGGAAATACATCTGGGCGTTTCTCCCAAATCTGAGTCTCGTTATGCCTTTTTGTTGGTCGACTGAAGAAGCCAACCAATTTCA...

Protein

Download Protein FASTA

452 aa · TkA08G202300|TK1151|PROTEIN

MMNLSSRKVMCKRQKQSSACDEIKEGEDFISKLPNALLIVILSFLPEADAVRTCILSNRWKYIWAFLPNLSLVMPFCWSTEEANQFHDFVDRILDLRVGLSCRRFYLYCSKNCDYNRVYDCLCTMVKNKVEKIDLRFPADRFIVKFCWDLFRTSYTLVQLTLRGEFVLDVPEAEVLFPCLKKLNLISIAYVGDQVVTNLISGCPLLQELFVERQLIGHSDNMEMFKVTSHSLRRLRMSFASCVDGDYKVVIDAPNLKYMY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G202300`
TK1151 ID	TkA08G202300
OH-1004 ID	LXL04_032741
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G202300

Location Chr08:52918784-52920461 (-)

Description Similar to At5g44950: Putative F-box/FBD/LRR-repeat protein At5g44950

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g44950`	Putative F-box/FBD/LRR-repeat protein At5g44950.	No verified direct reference in this release
`At3g59240`	Putative F-box/FBD/LRR-repeat protein At3g59240.	No verified direct reference in this release
`At4g14103`	F-box/LRR-repeat protein At4g14103.	No verified direct reference in this release
`At4g14096`	F-box/LRR-repeat protein At4g14096.	No verified direct reference in this release
`At2g26860`	FBD-associated F-box protein At2g26860.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032741 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT2G04230

ath:AT3G49030

ath:AT3G59190

ath:AT4G14103

ath:AT5G44950

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.806

Rank 1 · TkA08G202300 · TK1151

Cytoplasm0.269

Rank 2 · TkA08G202300 · TK1151

Cell membrane0.037

Rank 3 · TkA08G202300 · TK1151

Endoplasmic reticulum0.035

Rank 4 · TkA08G202300 · TK1151

Plastid0.018

Rank 5 · TkA08G202300 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646F-box30-65 aa

PF12937F-box-like30-63 aa

PF12937F-box-like96-116 aa

PF00646F-box97-112 aa

PF24758LRR_At5g56370128-263 aa

PF00646F-box174-188 aa

PF07723LRR_2179-204 aa

PF08387FBD179-184 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G202300	`PF00646`	F-box	30	65	4.3e-05	24.0
TkA08G202300	`PF12937`	F-box-like	30	63	0.00094	19.6
TkA08G202300	`PF12937`	F-box-like	96	116	0.00094	19.6
TkA08G202300	`PF00646`	F-box	97	112	4.3e-05	24.0
TkA08G202300	`PF24758`	LRR_At5g56370	128	263	9.2e-11	42.5
TkA08G202300	`PF00646`	F-box	174	188	4.3e-05	24.0
TkA08G202300	`PF07723`	LRR_2	179	204	3.5e-06	28.1
TkA08G202300	`PF08387`	FBD	179	184	0.0007	20.1
TkA08G202300	`PF24758`	LRR_At5g56370	296	332	9.2e-11	42.5
TkA08G202300	`PF08387`	FBD	382	424	0.0007	20.1
TkA08G202300	`PF24758`	LRR_At5g56370	409	429	9.2e-11	42.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FLA2`	Arabidopsis thaliana	sp\|Q9FLA2\|FDL34_ARATH Putative F-box/FBD/LRR-repeat protein At5g44950	29.500%	Swiss-Prot	Low
`Q9LX47`	Arabidopsis thaliana	sp\|Q9LX47\|FDL46_ARATH Putative F-box/FBD/LRR-repeat protein At3g59240	29.500%	Swiss-Prot	Low
`Q8L7H1`	Arabidopsis thaliana	sp\|Q8L7H1\|FBL75_ARATH F-box/LRR-repeat protein At4g14103	29.100%	Swiss-Prot	Low
`Q94B46`	Arabidopsis thaliana	sp\|Q94B46\|FBL74_ARATH F-box/LRR-repeat protein At4g14096	29.200%	Swiss-Prot	Low
`Q84X02`	Arabidopsis thaliana	sp\|Q84X02\|FBD7_ARATH FBD-associated F-box protein At2g26860	29.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card