TkA08G194810 | RubberDandelionOmics

Gene overview

TkA08G194810

Reference: TK1151 Chr: Chr08 Coordinates: 50900311-50903893 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1906 bp · TkA08G194810|TK1151|cDNA

CGCAAAGCAACGGTGGTCATTGTCCGTCTGATTACACACGCGTCGCCACACCCGGACTCCAAACACAAATTCCATTCTGCTTTCCTACAAAACATTTCGATTCCGTCCAATAATAATTACTCCCCCCTTTGTCACAATTATCCTCTGTGTTTTTTTTGTCACATCCGAGAATCTTATGAAGGAATTCCGTCGATCGGAGCTTTTCTTTTCACTAGAGTGAGTGAATCGCGAGTTCCCTTCTGATCGTACTCATGAATCAG...

CDS

Download CDS FASTA

822 bp · TkA08G194810|TK1151|CDS

ATGGAATTGACCCCTTTCCGCCAAGACCTAATCCCCAATTCTCCTCAAGACCACAACGTTAATGGAAACGGAATCACACACAAAAGATCACGAAAGCCCACAAAAAGATACATCGATGAGTCGTCAAATCAATCGCTCAAAAACTGTAAAAAAAGAAAAGAACCTTCGTCATCGTCAATTTCAAAAGTCAAAACGTCAACCGTCCGACGTGTCAAATGTCAAAACGAAGTCAAACCTAAAGAAATCACGCCGTTTTCCGA...

Protein

Download Protein FASTA

273 aa · TkA08G194810|TK1151|PROTEIN

MELTPFRQDLIPNSPQDHNVNGNGITHKRSRKPTKRYIDESSNQSLKNCKKRKEPSSSSISKVKTSTVRRVKCQNEVKPKEITPFSEISFGKAIQVPFISQCPTESQKTTPPPPTMMENVIERCSSGSEDDDSETTMRSMTGGSQRKLHRLWTVSEVKKLIDGVAHFGVGKWTHIKKLLFSSSVHRTPVDLKDKWRNLLKASRALKGSRIEDEQKRSQPWRPLPKSILCRVRELASTYPYPREGNSKILKSKYPNVPHVS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G194810`
TK1151 ID	TkA08G194810
OH-1004 ID	LXL04_032663
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 57.113 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G194810`
Location	Chr08:50900311-50903893 (+)
Description	Similar to TRP5: Telomere repeat-binding protein 5
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_032663` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000723 telomere maintenance Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0032204 regulation of telomere maintenance Biological Process GO:0000781 chromosome, telomeric region Cellular Component GO:0005634 nucleus Cellular Component GO:0003677 DNA binding Molecular Function GO:0003691 double-stranded telomeric DNA binding Molecular Function GO:0008301 DNA binding, bending Molecular Function GO:0042162 telomeric DNA binding Molecular Function GO:0042803 protein homodimerization activity Molecular Function
KEGG gene cross-reference	ath:AT1G07540 ath:AT3G46590 ath:AT3G53790 ath:AT5G13820 dosa:Os02g0817800 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.983

Rank 1 · TkA08G194810 · TK1151

Cytoplasm0.061

Rank 2 · TkA08G194810 · TK1151

Cell membrane0.019

Rank 3 · TkA08G194810 · TK1151

Endoplasmic reticulum0.012

Rank 4 · TkA08G194810 · TK1151

Plastid0.010

Rank 5 · TkA08G194810 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13837Myb_DNA-bind_445-63 aa

PF13837Myb_DNA-bind_4151-213 aa

PF00249Myb_DNA-binding152-199 aa

PF13921Myb_DNA-bind_6152-203 aa

PF23588HTH_CHD1_Hrp3152-177 aa

PF13873Myb_DNA-bind_5172-203 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G194810	`PF13837`	Myb_DNA-bind_4	45	63	0.00012	23.2
TkA08G194810	`PF13837`	Myb_DNA-bind_4	151	213	0.00012	23.2
TkA08G194810	`PF00249`	Myb_DNA-binding	152	199	2.8e-09	37.7
TkA08G194810	`PF13921`	Myb_DNA-bind_6	152	203	5.2e-07	30.5
TkA08G194810	`PF23588`	HTH_CHD1_Hrp3	152	177	0.03	15.1
TkA08G194810	`PF13873`	Myb_DNA-bind_5	172	203	0.037	14.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card