TkA08G190700 | RubberDandelionOmics

Gene overview

TkA08G190700

Reference: TK1151 Chr: Chr08 Coordinates: 49840026-49841090 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

840 bp · TkA08G190700|TK1151|cDNA

ATGTTACAAGAACGACTCGAACAGCGTTTTGATTCCCTGGAGCCCCGACCTAGCTGTATGATATCTGATAAATACATGCTCTGGACTGCTGGATTACCTGATCGTATTGAGATAACCAGAGGACAACTCCCACCCGAGTTCAACCCCAGTCCTTTCTCTAAACCAGAGCATCTTGAACGAGTACGAGAAATCGAGTCAAAAGCTGCCGCTAATTACAGGATCGTGATCAACAGCTTTGAGGAGTTAGAGCAGGAATACGT...

CDS

Download CDS FASTA

840 bp · TkA08G190700|TK1151|CDS

ATGTTACAAGAACGACTCGAACAGCGTTTTGATTCCCTGGAGCCCCGACCTAGCTGTATGATATCTGATAAATACATGCTCTGGACTGCTGGATTACCTGATCGTATTGAGATAACCAGAGGACAACTCCCACCCGAGTTCAACCCCAGTCCTTTCTCTAAACCAGAGCATCTTGAACGAGTACGAGAAATCGAGTCAAAAGCTGCCGCTAATTACAGGATCGTGATCAACAGCTTTGAGGAGTTAGAGCAGGAATACGT...

Protein

Download Protein FASTA

279 aa · TkA08G190700|TK1151|PROTEIN

MLQERLEQRFDSLEPRPSCMISDKYMLWTAGLPDRIEITRGQLPPEFNPSPFSKPEHLERVREIESKAAANYRIVINSFEELEQEYVTELKKLKGGNVWCLGPLSLSNHNDSGKSLRGSSSQVTPPQLIELGLGLESSNRPFIWVIRAGNKANELEEWITETGFEERVKNRGLLIRNWAPQLLILSHPSVGAFLTHCGWNSILEGVSAGIPLVTWPQFAEQFLNEKLVVEVLQIGVRVGAEVMVHWGEEDKFGVTVKREK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G190700`
TK1151 ID	TkA08G190700
OH-1004 ID	LXL04_032604
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	78.300
Protein coverage (%)	TK1151 98.566 / OH-1004 34.965 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G190700

Location Chr08:49840026-49841090 (+)

Description Similar to UGT73C5: UDP-glycosyltransferase 73C5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g36800`	Specifically catalyzes 23-O-glucosylation of brassinosteroids, resulting probably in their inactivation.	Detoxification of the Fusarium mycotoxin deoxynivalenol by a UDP-glucosyltransferase from Arabidopsis thaliana.2003 · DOI: 10.1074/jbc.m307552200 N-glucosylation of cytokinins by glycosyltransferases of Arabidopsis thaliana.2004 · DOI: 10.1074/jbc.m409569200 The UGT73C5 of Arabidopsis thaliana glucosylates brassinosteroids.2005 · DOI: 10.1073/pnas.0504279102
`At2g36780`	UDP-glycosyltransferase 73C3.	No verified direct reference in this release
`At2g36790`	Acts as a UDP-glucose:flavonol-3-O-glycoside-7-O- glucosyltransferase. 6- and 7-hydroxyflavone, but not 3- or 5- hydroxyflavone are accepted as substrates.	UGT73C6 and UGT78D1, glycosyltransferases involved in flavonol glycoside biosynthesis in Arabidopsis thaliana.2003 · DOI: 10.1074/jbc.m303523200

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032604 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0016134 saponin metabolic process Biological Process

GO:0035251 UDP-glucosyltransferase activity Molecular Function

GO:0046527 glucosyltransferase activity Molecular Function

KEGG gene cross-reference

ag:AFN26667

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.798

Rank 1 · TkA08G190700 · TK1151

Nucleus0.222

Rank 2 · TkA08G190700 · TK1151

Peroxisome0.062

Rank 3 · TkA08G190700 · TK1151

Endoplasmic reticulum0.061

Rank 4 · TkA08G190700 · TK1151

Plastid0.044

Rank 5 · TkA08G190700 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00201UDPGT127-231 aa

PF06722EryCIII-like_C188-231 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G190700	`PF00201`	UDPGT	127	231	6.2e-18	65.6
TkA08G190700	`PF06722`	EryCIII-like_C	188	231	0.059	14.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZQ94`	Arabidopsis thaliana	sp\|Q9ZQ94\|U73C5_ARATH UDP-glycosyltransferase 73C5	47.700%	Swiss-Prot	Medium
`Q9ZQ96`	Arabidopsis thaliana	sp\|Q9ZQ96\|U73C3_ARATH UDP-glycosyltransferase 73C3	47.200%	Swiss-Prot	Medium
`Q9ZQ95`	Arabidopsis thaliana	sp\|Q9ZQ95\|U73C6_ARATH UDP-glycosyltransferase 73C6	46.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card