TkA08G188130 | RubberDandelionOmics

Gene overview

TkA08G188130

Reference: TK1151 Chr: Chr08 Coordinates: 49139863-49142430 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1638 bp · TkA08G188130|TK1151|cDNA

CCACCACCCAGGGGCAAAATGGTAAAAATAAAGAAAGCGGCCACAAGAAGGCCTTCTGTAGGAGATGCCAGATTCGGGGCGATGATACCAATGCCTCTCTCTTCTTTAATATAAACCCTCACCCGCCTCCTTTGACTCTATTCGACTCCCATTTTCCCCTAATTTCTCTCTGAATTTTGTGTTAGATCTCAAATATCGCAGTCATGTCTTGCTACAGAGGAAAGTATGCTGATGAACTTATTGCCAACGCTGCCTACATC...

CDS

Download CDS FASTA

1077 bp · TkA08G188130|TK1151|CDS

ATGTCTTGCTACAGAGGAAAGTATGCTGATGAACTTATTGCCAACGCTGCCTACATCGGAACCCCCGGAAAGGGTATTCTCGCTGCTGATGAGTCAACCGGCACAATCGGAAAGCGTCTATCCAGCATCAATGTCGAGAACATCGAGTCAAACAGAAGAGCACTTCGTGAACTCCTCTTCTGCACTCCTGGTGCCCTTCAGTACCTCAGTGGTGTCATCCTCTTCGAAGAAACTCTCTACCAAAAAACCGCCGCAGGCAA...

Protein

Download Protein FASTA

358 aa · TkA08G188130|TK1151|PROTEIN

MSCYRGKYADELIANAAYIGTPGKGILAADESTGTIGKRLSSINVENIESNRRALRELLFCTPGALQYLSGVILFEETLYQKTAAGKPFVDVMKEAGVLPGIKVDKGTVELAGTDGETTTQGLDSLAQRCAQYYTAGARFAKWRAVLKIGPNEPSQLAITENANGLARYAIICQENGLVPIVEPEILVDGSHDIAKCADVTERVLAACYKALNDHKVLLEGTLLKPNMVTPGSDSKKVAPEVVAEYTVRALQRTMPPAVP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G188130`
TK1151 ID	TkA08G188130
OH-1004 ID	LXL04_032561
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G188130

Location Chr08:49139863-49142430 (-)

Description Similar to FBA1: Fructose-bisphosphate aldolase 1, cytoplasmic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g36460`	Fructose-bisphosphate aldolase that plays a key role in glycolysis and gluconeogenesis.	Regulation of plant cytosolic aldolase functions by redox-modifications.2011 · DOI: 10.1016/j.plaphy.2011.06.009 Transfer of a Redox-Signal through the Cytosol by Redox-Dependent Microcompartmentation of Glycolytic Enzymes at Mitochondria and Actin Cytoskeleton.2012 · DOI: 10.3389/fpls.2012.00284

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0402700`	Fructose-bisphosphate aldolase that plays a key role in glycolysis and gluconeogenesis (By similarity).	No verified direct reference in this release
`Os10g0163340`	Fructose-bisphosphate aldolase that plays a key role in glycolysis and gluconeogenesis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032561 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006094 gluconeogenesis Biological Process

GO:0006096 glycolytic process Biological Process

GO:0030388 fructose 1,6-bisphosphate metabolic process Biological Process

GO:0031930 mitochondria-nucleus signaling pathway Biological Process

GO:0048364 root development Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT2G36460

cam:101501462

dosa:Os05g0402700

osa:4338737

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.769

Rank 1 · TkA08G188130 · TK1151

Nucleus0.286

Rank 2 · TkA08G188130 · TK1151

Mitochondrion0.113

Rank 3 · TkA08G188130 · TK1151

Cell membrane0.075

Rank 4 · TkA08G188130 · TK1151

Peroxisome0.057

Rank 5 · TkA08G188130 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00274Glycolytic11-358 aa

PF14280DUF4365239-308 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G188130	`PF00274`	Glycolytic	11	358	1.1e-173	577.7
TkA08G188130	`PF14280`	DUF4365	239	308	0.18	12.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SJQ9`	Arabidopsis thaliana	sp\|Q9SJQ9\|ALFC6_ARATH Fructose-bisphosphate aldolase 6, cytosolic	84.600%	Swiss-Prot	High
`P17784`	Oryza sativa subsp. japonica	sp\|P17784\|ALFC1_ORYSJ Fructose-bisphosphate aldolase 1, cytoplasmic	84.100%	Swiss-Prot	High
`Q10A30`	Oryza sativa subsp. japonica	sp\|Q10A30\|ALFC2_ORYSJ Fructose-bisphosphate aldolase 2, cytoplasmic	83.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card