TkA08G185370 | RubberDandelionOmics

Gene overview

TkA08G185370

Reference: TK1151 Chr: Chr08 Coordinates: 48450935-48455020 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1660 bp · TkA08G185370|TK1151|cDNA

AAATGTCCAACAACTGAATCAAACTTGCGAAACCGTACCACCCAATCATCAATCATCATCATTATTTTTGTTTTGTTACCCATCGACATTCTGCAACACCATTTAAAAGCTTCAGATCCTCACATCTTAACCCCTCACTCTTCCTTTCTCATATACCTTCAGCTTTCTCATTCTCTCTGTCGTTGCGATATGAGTTTTCTTAAGTTCTGGTTGCTAGTGCTGGTGGCCGTCGTGTTCGCCGGAGCCCTGGAAATTGCGCA...

CDS

Download CDS FASTA

1479 bp · TkA08G185370|TK1151|CDS

AAATGTCCAACAACTGAATCAAACTTGCGAAACCGTACCACCCAATCATCAATCATCATCATTATTTTTGTTTTGTTACCCATCGACATTCTGCAACACCATTTAAAAGCTTCAGATCCTCACATCTTAACCCCTCACTCTTCCTTTCTCATATACCTTCAGCTTTCTCATTCTCTCTGTCGTTGCGATATGAGTTTTCTTAAGTTCTGGTTGCTAGTGCTGGTGGCCGTCGTGTTCGCCGGAGCCCTGGAAATTGCGCA...

Protein

Download Protein FASTA

492 aa · TkA08G185370|TK1151|PROTEIN

KCPTTESNLRNRTTQSSIIIIIFVLLPIDILQHHLKASDPHILTPHSSFLIYLQLSHSLCRCDMSFLKFWLLVLVAVVFAGALEIAHAYDRPPPREDLVVSVAGDAGPTTPQQVHISLAGKDKIRISWITDKHTPATVSYGTSSRKYEHSATGAISSYEYLTYTSGEIHDVVIGPLNPNTVYYYCFAPGSTPEYSFKTPPAQLPIKFAISGDLGQTGWTKSTLEHISESNSDVFLLPGDLSYADMMQPLWDSFGRLVEPL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G185370`
TK1151 ID	TkA08G185370
OH-1004 ID	LXL04_005223
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	67.600
Protein coverage (%)	TK1151 85.163 / OH-1004 96.970 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G185370

Location Chr08:48450935-48455020 (-)

Description Similar to PAP20: Probable purple acid phosphatase 20

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g52780`	Probable purple acid phosphatase 20.	No verified direct reference in this release
`At3g52820`	Purple acid phosphatase 22.	No verified direct reference in this release
`At3g20500`	Purple acid phosphatase 18.	No verified direct reference in this release
`At3g52810`	Purple acid phosphatase 21.	No verified direct reference in this release
`At5g34850`	Metallo-phosphoesterase involved in phosphate metabolism.	Biochemical and molecular characterization of AtPAP26, a vacuolar purple acid phosphatase up-regulated in phosphate-deprived Arabidopsis suspension cells and seedlings.2006 · DOI: 10.1104/pp.106.087171

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005223 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0042744 hydrogen peroxide catabolic process Biological Process

GO:0051174 regulation of phosphorus metabolic process Biological Process

GO:0055062 phosphate ion homeostasis Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005773 vacuole Cellular Component

GO:0009536 plastid Cellular Component

GO:0099503 secretory vesicle Cellular Component

GO:0003993 acid phosphatase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

GO:0140825 lactoperoxidase activity Molecular Function

KEGG gene cross-reference

ath:AT3G20500

ath:AT3G52780

ath:AT3G52810

ath:AT3G52820

ath:AT5G34850

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.481

Rank 1 · TkA08G185370 · TK1151

Extracellular0.199

Rank 2 · TkA08G185370 · TK1151

Cytoplasm0.144

Rank 3 · TkA08G185370 · TK1151

Endoplasmic reticulum0.132

Rank 4 · TkA08G185370 · TK1151

Cell membrane0.122

Rank 5 · TkA08G185370 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16656Pur_ac_phosph_N111-198 aa

PF00149Metallophos206-399 aa

PF09937DUF2169357-400 aa

PF14008Metallophos_C414-474 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G185370	`PF16656`	Pur_ac_phosph_N	111	198	7.9e-20	72.0
TkA08G185370	`PF00149`	Metallophos	206	399	4.2e-20	73.7
TkA08G185370	`PF09937`	DUF2169	357	400	0.11	12.6
TkA08G185370	`PF14008`	Metallophos_C	414	474	1.7e-17	64.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LXI7`	Arabidopsis thaliana	sp\|Q9LXI7\|PPA20_ARATH Probable purple acid phosphatase 20	67.100%	Swiss-Prot	High
`Q8S340`	Arabidopsis thaliana	sp\|Q8S340\|PPA22_ARATH Purple acid phosphatase 22	60.800%	Swiss-Prot	High
`Q9LJU7`	Arabidopsis thaliana	sp\|Q9LJU7\|PPA18_ARATH Purple acid phosphatase 18	59.900%	Swiss-Prot	High
`Q9LXI4`	Arabidopsis thaliana	sp\|Q9LXI4\|PPA21_ARATH Purple acid phosphatase 21	56.100%	Swiss-Prot	High
`Q949Y3`	Arabidopsis thaliana	sp\|Q949Y3\|PPA26_ARATH Bifunctional purple acid phosphatase 26	42.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card