TkA08G185140 | RubberDandelionOmics

Gene overview

TkA08G185140

Reference: TK1151 Chr: Chr08 Coordinates: 48369438-48378033 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

905 bp · TkA08G185140|TK1151|cDNA

TTTACATTTTACCTTCGTTATTTTTATTTGTAACCAATCATTTTTTAACCGTACGTCCAAACACCCCTAAATGAACCCTAAAATGGCAAAGGGGGAGGTGACTATAGCTCGGAGTCGGAGGTACTCATCTATTCGATTTCTGAGAGAGAAAACAGAGAAAGATGAGTGGTGTCGGAAAGAAGGTGGCGGATGTGGCATTCAAGGCATCTAAATCCATCGATTGGGATGGGATGGCGAAGATGATCGTCACCGATGAAGCT...

CDS

Download CDS FASTA

1026 bp · TkA08G185140|TK1151|CDS

ATGAGGTCGAGCAACCATCTGATTGGTATGTTAAACTTCCTGACGTTCCTCCTATCGATTCCGATTCTCGGTGGCGGAATATGGCTGAGCACGCGAGCCAACAACACCGATTGCATGAGCTTCCTCCAGTGGCCGTTGATAGTCATCGGCGTCGCAATCATGGTAGTCTCACTCGCTGGATTCGCCGGCGCGTGTTACCGGAACACTTTCGTAATGTACCTTTACCTGTGGGCGATGTTCTTCATCATCGCTCTGCTTAT...

Protein

Download Protein FASTA

341 aa · TkA08G185140|TK1151|PROTEIN

MRSSNHLIGMLNFLTFLLSIPILGGGIWLSTRANNTDCMSFLQWPLIVIGVAIMVVSLAGFAGACYRNTFVMYLYLWAMFFIIALLIGFVIFAYVVTDKGSGRPVMNRAYDDYYLPDYSGWLKDRVASDSYWRKISSCIRDSKACGKTGRVVGGFPESADMYYQRKLNPIERKMSGVGKKVADVAFKASKSIDWDGMAKMIVTDEARKEFSSLRRAFEEVNSTLQTKFSQEPEPIDWEYYRKGLGSRIVDSYKEYYESVE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G185140`
TK1151 ID	TkA08G185140
OH-1004 ID	LXL04_032533
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	74.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G185140

Location Chr08:48369438-48378033 (-)

Description Similar to TET3: Tetraspanin-3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g45600`	May be involved in the regulation of cell differentiation.	No verified direct reference in this release
`At5g60220`	May be involved in the regulation of cell differentiation.	No verified direct reference in this release
`At3g52300`	Mitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V) produces ATP from ADP in the presence of a proton gradient across the membrane which is generated by electron transport complexes of the respiratory chain.	No verified direct reference in this release
`At2g23810`	May be involved in the regulation of cell differentiation.	No verified direct reference in this release
`At4g30430`	May be involved in the regulation of cell differentiation.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032533 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006890 retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0015986 proton motive force-driven ATP synthesis Biological Process

GO:0050829 defense response to Gram-negative bacterium Biological Process

GO:0090110 COPII-coated vesicle cargo loading Biological Process

GO:0099039 sphingolipid translocation Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0005773 vacuole Cellular Component

KEGG gene cross-reference

ath:AT2G23810

ath:AT3G45600

ath:AT3G52300

ath:AT4G30430

ath:AT5G60220

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.641

Rank 1 · TkA08G185140 · TK1151

Cytoplasm0.144

Rank 2 · TkA08G185140 · TK1151

Lysosome / Vacuole0.119

Rank 3 · TkA08G185140 · TK1151

Endoplasmic reticulum0.111

Rank 4 · TkA08G185140 · TK1151

Golgi apparatus0.071

Rank 5 · TkA08G185140 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00335Tetraspanin5-140 aa

PF00487FA_desaturase23-95 aa

PF26566PH_4039-99 aa

PF14023Bestrophin-like41-97 aa

PF05227CHASE3187-230 aa

PF05873Mt_ATP-synt_D188-339 aa

PF14023Bestrophin-like192-222 aa

PF29423DUF8546201-231 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G185140	`PF00335`	Tetraspanin	5	140	4.7e-25	89.3
TkA08G185140	`PF00487`	FA_desaturase	23	95	2.0	8.8
TkA08G185140	`PF26566`	PH_40	39	99	0.44	11.3
TkA08G185140	`PF14023`	Bestrophin-like	41	97	1.6	9.0
TkA08G185140	`PF05227`	CHASE3	187	230	0.35	11.5
TkA08G185140	`PF05873`	Mt_ATP-synt_D	188	339	8e-18	65.5
TkA08G185140	`PF14023`	Bestrophin-like	192	222	1.6	9.0
TkA08G185140	`PF29423`	DUF8546	201	231	0.69	11.1
TkA08G185140	`PF28547`	CHD_PDZ-protease	204	220	1.4	9.8
TkA08G185140	`PF28547`	CHD_PDZ-protease	263	338	1.4	9.8
TkA08G185140	`PF05227`	CHASE3	279	315	0.35	11.5
TkA08G185140	`PF29423`	DUF8546	282	337	0.69	11.1
TkA08G185140	`PF14023`	Bestrophin-like	294	315	1.6	9.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M1E7`	Arabidopsis thaliana	sp\|Q9M1E7\|TET3_ARATH Tetraspanin-3	68.100%	Swiss-Prot	High
`Q9LSS4`	Arabidopsis thaliana	sp\|Q9LSS4\|TET4_ARATH Tetraspanin-4	68.800%	Swiss-Prot	High
`Q9FT52`	Arabidopsis thaliana	sp\|Q9FT52\|ATP5H_ARATH ATP synthase subunit d, mitochondrial	85.100%	Swiss-Prot	High
`Q8S8Q6`	Arabidopsis thaliana	sp\|Q8S8Q6\|TET8_ARATH Tetraspanin-8	46.900%	Swiss-Prot	Medium
`Q9M0B7`	Arabidopsis thaliana	sp\|Q9M0B7\|TET9_ARATH Tetraspanin-9	43.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card