TkA08G176620 | RubberDandelionOmics

Gene overview

TkA08G176620

Reference: TK1151 Chr: Chr08 Coordinates: 46204817-46209976 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3469 bp · TkA08G176620|TK1151|cDNA

ACAACAAACTCATCATCATCATCTCAATTCTCACATCCTCCTCTTTTCCCTTTACTCTTTCTATCCCACAGTGTGCTTCTTCTCTCTTCAATGGCTTCTCTCTTCAGTAGAGAAAGAATACTAGGCCAATCCAAGAGAGACTCAAACGGCCCAGCCATGAACGGAACTAACAGCTTCCGCTTCACATCCGCCGCCGCTACCACCACCACCACCACTCACACCACTTTAGATCCACTCCCATCGCCATTCGGTGACCTCAC...

CDS

Download CDS FASTA

3015 bp · TkA08G176620|TK1151|CDS

ATGGCTTCTCTCTTCAGTAGAGAAAGAATACTAGGCCAATCCAAGAGAGACTCAAACGGCCCAGCCATGAACGGAACTAACAGCTTCCGCTTCACATCCGCCGCCGCTACCACCACCACCACCACTCACACCACTTTAGATCCACTCCCATCGCCATTCGGTGACCTCACGCCAACTTTATCCCTCACTGACCTCCGTGAAACAGCTTACGAGATCTTCGTTTCAGTCTGTCGTACATCTATCGGAAAACCCCTCACTTG...

Protein

Download Protein FASTA

1004 aa · TkA08G176620|TK1151|PROTEIN

MASLFSRERILGQSKRDSNGPAMNGTNSFRFTSAAATTTTTTHTTLDPLPSPFGDLTPTLSLTDLRETAYEIFVSVCRTSIGKPLTCISNNASSYTPDRSSQSPSLSGSPSQRSITSTAASKMKKALGLRSSSSVGSPGSAGSGTGSGGKAKKTVMTVGDLMRIQMRVSEAADSRIKRALLRTSAGQAQKRVELIVLPLELLQQFKSSDFTDQQEYATWQKRNLKILEAGLLLHPHIPLPSSNPSSQRLKQIIQNALQNP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G176620`
TK1151 ID	TkA08G176620
OH-1004 ID	LXL04_032456
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.600
Protein coverage (%)	TK1151 56.175 / OH-1004 97.747 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G176620

Location Chr08:46204817-46209976 (-)

Description Similar to PATROL1: Protein unc-13 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g06970`	Controls the tethering of the proton ATPase AHA1 to the plasma membrane.	A Munc13-like protein in Arabidopsis mediates H+-ATPase translocation that is essential for stomatal responses.2013 · DOI: 10.1038/ncomms3215

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032456 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0010118 stomatal movement Biological Process

GO:0072659 protein localization to plasma membrane Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

KEGG gene cross-reference

ath:AT5G06970

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.475

Rank 1 · TkA08G176620 · TK1151

Cell membrane0.387

Rank 2 · TkA08G176620 · TK1151

Nucleus0.227

Rank 3 · TkA08G176620 · TK1151

Golgi apparatus0.117

Rank 4 · TkA08G176620 · TK1151

Lysosome / Vacuole0.089

Rank 5 · TkA08G176620 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF27629UNC13_3rd250-282 aa

PF27629UNC13_3rd343-445 aa

PF25761TPR_PATROL1602-1003 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G176620	`PF27629`	UNC13_3rd	250	282	6e-23	82.0
TkA08G176620	`PF27629`	UNC13_3rd	343	445	6e-23	82.0
TkA08G176620	`PF25761`	TPR_PATROL1	602	1003	4.8e-163	543.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RX56`	Arabidopsis thaliana	sp\|Q8RX56\|UNC13_ARATH Protein unc-13 homolog	31.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card