TkA08G173940 | RubberDandelionOmics

Gene overview

TkA08G173940

Reference: TK1151 Chr: Chr08 Coordinates: 45481538-45481897 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

360 bp · TkA08G173940|TK1151|cDNA

ATGGAGGCTATGGTCAAGGTATTATTTTATCTCTTTTTCATCTTGCTGTTGCTGGTTAACTCGGTGTTGACCCAGTCCACGGTGCGGCCACTGAGTTCCGGTGTAGAAAGAACGGCGCTGCTGGATCTTCGAGCTTCTTTAGGAATAAAAGCCAGATACTGGCCGAGGAAATTAGACCCGTGTGCCAACTGGACAGGGGTGGAGTGCGGGAACGGCCGAGTCACCGGAATAAATTTGTCCGGTTTACGACGAACTCGTGT...

CDS

Download CDS FASTA

360 bp · TkA08G173940|TK1151|CDS

ATGGAGGCTATGGTCAAGGTATTATTTTATCTCTTTTTCATCTTGCTGTTGCTGGTTAACTCGGTGTTGACCCAGTCCACGGTGCGGCCACTGAGTTCCGGTGTAGAAAGAACGGCGCTGCTGGATCTTCGAGCTTCTTTAGGAATAAAAGCCAGATACTGGCCGAGGAAATTAGACCCGTGTGCCAACTGGACAGGGGTGGAGTGCGGGAACGGCCGAGTCACCGGAATAAATTTGTCCGGTTTACGACGAACTCGTGT...

Protein

Download Protein FASTA

119 aa · TkA08G173940|TK1151|PROTEIN

MEAMVKVLFYLFFILLLLVNSVLTQSTVRPLSSGVERTALLDLRASLGIKARYWPRKLDPCANWTGVECGNGRVTGINLSGLRRTRVGRLSPSFSIDSLVRCTQLSTFNASGFALPLIV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G173940`
TK1151 ID	TkA08G173940
OH-1004 ID	LXL04_008926
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	96.600
Protein coverage (%)	TK1151 97.479 / OH-1004 13.567 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G173940

Location Chr08:45481538-45481897 (+)

Description Similar to At2g16250: Probable LRR receptor-like serine/threonine-protein kinase At2g16250

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g16250`	Probable LRR receptor-like serine/threonine-protein kinase At2g16250.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008926 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009414 response to water deprivation Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009729 detection of brassinosteroid stimulus Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0009755 hormone-mediated signaling pathway Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005496 steroid binding Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G55610

ath:AT2G16250

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.283

Rank 1 · TkA08G173940 · TK1151

Cell membrane0.265

Rank 2 · TkA08G173940 · TK1151

Endoplasmic reticulum0.185

Rank 3 · TkA08G173940 · TK1151

Cytoplasm0.081

Rank 4 · TkA08G173940 · TK1151

Nucleus0.060

Rank 5 · TkA08G173940 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08263LRRNT_236-69 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G173940	`PF08263`	LRRNT_2	36	69	4.5e-06	27.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`C0LGK4`	Arabidopsis thaliana	sp\|C0LGK4\|Y2165_ARATH Probable LRR receptor-like serine/threonine-protein kinase At2g16250	56.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card