TkA08G170780 | RubberDandelionOmics

Gene overview

TkA08G170780

Reference: TK1151 Chr: Chr08 Coordinates: 44668216-44672650 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3777 bp · TkA08G170780|TK1151|cDNA

AAATTATGCATCAATTAGTTGACATTTGTTACTATAAACAACTATTATGTATGCGGTACATATGAATATGATTCAAGTTTAACCCAACTTGGTCACCTTTCCATTCACCGTCGTTCTCCTCGTCCGCGGCCAAACGATGGAGCCGGACGTCAGCATCGACACCAGTTCCATGATCCGGATAGCCGTCATCCCAATCGGAATTATCCAGCCACACCAATTCCGAAACTACGTTGCAATGCTCGGCCGCCACCACAATATGG...

CDS

Download CDS FASTA

2160 bp · TkA08G170780|TK1151|CDS

ATGGGTAAAACAGGGGAGACGGATACAGCTTTAGTGGAGGAGGTAAAGCAACGCTACAATGGTGTCATAACTCATTATCGCAAGTCATTCACACCAGAAAATTCTCAAAGGGTTTCGCCTCTGAGCTTTGAACTTGAAGCTACTTTGAAACTGGCGAGATTTCTGTGCGGACCAGAGCTAGTGAAGGAGGTAGTGGAGCTGTTGACTAATGCAACAGATGGAGCCAAATCATTGATTGATACAAGTGATCGATTGATATT...

Protein

Download Protein FASTA

719 aa · TkA08G170780|TK1151|PROTEIN

MGKTGETDTALVEEVKQRYNGVITHYRKSFTPENSQRVSPLSFELEATLKLARFLCGPELVKEVVELLTNATDGAKSLIDTSDRLILYVEIARLFGTLGYHRKAAFFSRQVAQLYMQQENNLAASSALQVLAMTTKAYRVQSRASIFNETGQYIVDGGKMNHHLVVSLFESHWSTLQMVVLKEILLSAVRAGDPLAAWSAAARLIRSYYPLITPPGQNRLANALVNSADRLPSGTHCSDPALPFIRLHSFPLHFSQMDII...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G170780`
TK1151 ID	TkA08G170780
OH-1004 ID	LXL04_015466
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	74.300
Protein coverage (%)	TK1151 96.662 / OH-1004 61.662 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G170780

Location Chr08:44668216-44672650 (-)

Description Similar to TRS120: Trafficking protein particle complex II-specific subunit 120 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g11040`	Specific subunit of the TRAPP II complex, a highly conserved vesicle tethering complex that is required for the proper transport of proteins in post-Golgi trafficking pathways to the growing cell plate in mitotic active cells.	Tethering factors required for cytokinesis in Arabidopsis.2010 · DOI: 10.1104/pp.110.154286 A specific role for Arabidopsis TRAPPII in post-Golgi trafficking that is crucial for cytokinesis and cell polarity.2011 · DOI: 10.1111/j.1365-313x.2011.04681.x VAN4 encodes a putative TRS120 that is required for normal cell growth and vein development in Arabidopsis.2014 · DOI: 10.1093/pcp/pcu012

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0502200`	Specific subunit of the TRAPP II complex, a highly conserved vesicle tethering complex that is required for the proper transport of proteins in post-Golgi trafficking pathways to the growing cell plate in mitotic active cells.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015466 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000911 cytokinesis by cell plate formation Biological Process

GO:0000919 cell plate assembly Biological Process

GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport Biological Process

GO:0006901 vesicle coating Biological Process

GO:0030154 cell differentiation Biological Process

GO:0099022 vesicle tethering Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005769 early endosome Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005802 trans-Golgi network Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT5G11040

bta:533451

dosa:Os04g0502200

hsa:83696

mmu:76510

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.445

Rank 1 · TkA08G170780 · TK1151

Nucleus0.344

Rank 2 · TkA08G170780 · TK1151

Golgi apparatus0.151

Rank 3 · TkA08G170780 · TK1151

Endoplasmic reticulum0.114

Rank 4 · TkA08G170780 · TK1151

Cell membrane0.078

Rank 5 · TkA08G170780 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26251TPR_TRAPPC9-Trs12012-58 aa

PF26251TPR_TRAPPC9-Trs12063-224 aa

PF26254Ig_TRAPPC9-Trs120_1st273-379 aa

PF24544Ig_TPPC8_2nd302-342 aa

PF26280Ig_TRAPPC9-Trs120_2nd426-475 aa

PF24544Ig_TPPC8_2nd441-464 aa

PF24544Ig_TPPC8_2nd469-528 aa

PF26280Ig_TRAPPC9-Trs120_2nd482-549 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G170780	`PF26251`	TPR_TRAPPC9-Trs120	12	58	3.2e-13	50.5
TkA08G170780	`PF26251`	TPR_TRAPPC9-Trs120	63	224	3.2e-13	50.5
TkA08G170780	`PF26254`	Ig_TRAPPC9-Trs120_1st	273	379	5e-22	79.3
TkA08G170780	`PF24544`	Ig_TPPC8_2nd	302	342	0.044	15.1
TkA08G170780	`PF26280`	Ig_TRAPPC9-Trs120_2nd	426	475	3.8e-05	24.4
TkA08G170780	`PF24544`	Ig_TPPC8_2nd	441	464	0.044	15.1
TkA08G170780	`PF24544`	Ig_TPPC8_2nd	469	528	0.044	15.1
TkA08G170780	`PF26280`	Ig_TRAPPC9-Trs120_2nd	482	549	3.8e-05	24.4
TkA08G170780	`PF26282`	Ig_TRAPPC9-Trs120_3rd	580	702	7.2e-07	29.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FY61`	Arabidopsis thaliana	sp\|Q9FY61\|TR120_ARATH Trafficking protein particle complex II-specific subunit 120 homolog	69.000%	Swiss-Prot	High
`Q0JBY9`	Oryza sativa subsp. japonica	sp\|Q0JBY9\|TR120_ORYSJ Trafficking protein particle complex II-specific subunit 120 homolog	60.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card