TkA08G169860 | RubberDandelionOmics

Gene overview

TkA08G169860

Reference: TK1151 Chr: Chr08 Coordinates: 44434318-44438323 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2769 bp · TkA08G169860|TK1151|cDNA

AATATAATAACATTCGGAAAATAATAAAATATGTAACGGTGATTTGCTATGTGTTCAAACTACAAGCTTTTAACGTGAGACCTTGGTGGGGGCATAAATGGTGTTTTACGACTTTATTTTCCTAAAACCTTGAAAACCATGGCTGCCACCAAATCACCCTCCCCAGCTATTGTCGACGAAGCAGCAGCAACGGCAGCATACCCGTATCCGTACACCGCCAATGTCGCCAATTTTGTATCCGTCAAGCTCTCCGGCCACGA...

CDS

Download CDS FASTA

2493 bp · TkA08G169860|TK1151|CDS

ATGGCTGCCACCAAATCACCCTCCCCAGCTATTGTCGACGAAGCAGCAGCAACGGCAGCATACCCGTATCCGTACACCGCCAATGTCGCCAATTTTGTATCCGTCAAGCTCTCCGGCCACGAGAAGTACCCGTTATGGAAGACACAGATGCTTTGTCTCATCGAAGGTCATGACATGCTTGGTTTCATCGACGGTACACTCGAACCCCCACCCGATACCAATCCGGACAATGCTCAGTGGTGGCGGAGGTCCGACGCGCT...

Protein

Download Protein FASTA

830 aa · TkA08G169860|TK1151|PROTEIN

MAATKSPSPAIVDEAAATAAYPYPYTANVANFVSVKLSGHEKYPLWKTQMLCLIEGHDMLGFIDGTLEPPPDTNPDNAQWWRRSDALLRGWILGSLTEDVLANIIGLKTAKDVWANLESSYGSLTPQSSFSAAVKGEIDAGEWKFDSNFMRSTPHSRSLPVPLRGVSQQIDLKGDSATPAIDSKISSRSRNSRGLESTIFQEESWTGNSPTLRSMDLAEFTDFIQEPTININAYLPLYKAALRGDWEDAQDFINQEPEAV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G169860`
TK1151 ID	TkA08G169860
OH-1004 ID	LXL04_032365
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.000
Protein coverage (%)	TK1151 99.759 / OH-1004 99.519 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G169860`
Location	Chr08:44434318-44438323 (+)
Description	Similar to ITN1: Ankyrin repeat-containing protein ITN1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_032365` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006310 DNA recombination Biological Process GO:0006508 proteolysis Biological Process GO:0009651 response to salt stress Biological Process GO:0015074 DNA integration Biological Process GO:0051017 actin filament bundle assembly Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005886 plasma membrane Cellular Component GO:0031941 filamentous actin Cellular Component GO:0003676 nucleic acid binding Molecular Function GO:0003964 RNA-directed DNA polymerase activity Molecular Function GO:0004190 aspartic-type endopeptidase activity Molecular Function
KEGG gene cross-reference	ath:AT3G12360 dosa:Os01g0837000 hsa:83715 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.840

Rank 1 · TkA08G169860 · TK1151

Endoplasmic reticulum0.091

Rank 2 · TkA08G169860 · TK1151

Cytoplasm0.074

Rank 3 · TkA08G169860 · TK1151

Lysosome / Vacuole0.036

Rank 4 · TkA08G169860 · TK1151

Nucleus0.034

Rank 5 · TkA08G169860 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14244Retrotran_gag_332-71 aa

PF14223Retrotran_gag_253-128 aa

PF13637Ank_4230-252 aa

PF12796Ank_2232-290 aa

PF13857Ank_5232-275 aa

PF13606Ank_3234-254 aa

PF13857Ank_5265-280 aa

PF13637Ank_4265-289 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G169860	`PF14244`	Retrotran_gag_3	32	71	1.7e-06	28.4
TkA08G169860	`PF14223`	Retrotran_gag_2	53	128	7.8e-09	36.2
TkA08G169860	`PF13637`	Ank_4	230	252	3.5e-08	34.2
TkA08G169860	`PF12796`	Ank_2	232	290	4.3e-15	56.8
TkA08G169860	`PF13857`	Ank_5	232	275	1e-08	36.0
TkA08G169860	`PF13606`	Ank_3	234	254	4.2e-07	30.4
TkA08G169860	`PF13857`	Ank_5	265	280	1e-08	36.0
TkA08G169860	`PF13637`	Ank_4	265	289	3.5e-08	34.2
TkA08G169860	`PF00023`	Ank	267	290	9.4e-08	32.7
TkA08G169860	`PF13606`	Ank_3	267	280	4.2e-07	30.4
TkA08G169860	`PF12796`	Ank_2	286	362	4.3e-15	56.8
TkA08G169860	`PF13857`	Ank_5	303	348	1e-08	36.0
TkA08G169860	`PF13637`	Ank_4	305	322	3.5e-08	34.2
TkA08G169860	`PF13606`	Ank_3	307	330	4.2e-07	30.4
TkA08G169860	`PF00023`	Ank	308	328	9.4e-08	32.7
TkA08G169860	`PF13637`	Ank_4	311	361	3.5e-08	34.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card