TkA08G169070 | RubberDandelionOmics

Gene overview

TkA08G169070

Reference: TK1151 Chr: Chr08 Coordinates: 44206448-44211672 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2855 bp · TkA08G169070|TK1151|cDNA

TAAGTTTAGGTTTTCACTCTCATCACTGTCACTCATCGTTTTGTGGTTTCCTGTGGAGAGGAGCAGCACATACTGAACAACTTGCAGACTCCATTTCCTCATCAACATCATCAGAAAGAGTGTTTTGAGGAATGCTGGATTGATTGGCCCCAAATTCAAAGAAGATGAGCAAGAAGAACCCGCTTGTATACTTGGATGTATCTATAGATGGAGATCCTGTTGAAAGGATGGTTTTTGAGCTTTTCTCAGACAGTGTTCCC...

CDS

Download CDS FASTA

2223 bp · TkA08G169070|TK1151|CDS

ATGAGCAAGAAGAACCCGCTTGTATACTTGGATGTATCTATAGATGGAGATCCTGTTGAAAGGATGGTTTTTGAGCTTTTCTCAGACAGTGTTCCCAAGACTGCTGAGAACTTTCGGGCACTTTGTACTGGAGAAAAAGGGAATAGTCAGAAAACTGGGAAACCTCTACACTACAAGGGATCTTTCTTTCATCGCATAATCAAAGGATCAATGGCTCAGGGTGGGGATTTTTATAAACGAGACGGAAGTTATGGAGAAAG...

Protein

Download Protein FASTA

740 aa · TkA08G169070|TK1151|PROTEIN

MSKKNPLVYLDVSIDGDPVERMVFELFSDSVPKTAENFRALCTGEKGNSQKTGKPLHYKGSFFHRIIKGSMAQGGDFYKRDGSYGESIYGGKFPDESSKLKHDAPGLLTMAIADRDSRGSLFNVTFAANRHLDRKYVVFGKLVQGIDVLKKMENVGDEDGIPTVTLKIIYCGEIAESENQSSDKKVANKLKTGKDVSSEVHSHEVKRKSKHKKSSKARRKKRKRYSSSDSDSSSSDVDSDSSDSDTDSDSDTSSSSSSDL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G169070`
TK1151 ID	TkA08G169070
OH-1004 ID	LXL04_032354
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G169070

Location Chr08:44206448-44211672 (+)

Description Similar to CYP95: Peptidyl-prolyl cis-trans isomerase CYP95

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g32420`	PPIases accelerate the folding of proteins.	No verified direct reference in this release
`At3g63400`	PPIases accelerate the folding of proteins.	No verified direct reference in this release
`At4g38740`	PPIases accelerate the folding of proteins.	No verified direct reference in this release
`At2g21130`	PPIases accelerate the folding of proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032354 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0006457 protein folding Biological Process

GO:0008380 RNA splicing Biological Process

GO:0015031 protein transport Biological Process

GO:0019076 viral release from host cell Biological Process

GO:0034389 lipid droplet organization Biological Process

GO:0045070 positive regulation of viral genome replication Biological Process

GO:0050714 positive regulation of protein secretion Biological Process

GO:0065003 protein-containing complex assembly Biological Process

GO:0071492 cellular response to UV-A Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

KEGG gene cross-reference

ath:AT3G63400

ath:AT4G32420

hsa:5481

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.977

Rank 1 · TkA08G169070 · TK1151

Cytoplasm0.089

Rank 2 · TkA08G169070 · TK1151

Cell membrane0.016

Rank 3 · TkA08G169070 · TK1151

Endoplasmic reticulum0.008

Rank 4 · TkA08G169070 · TK1151

Mitochondrion0.007

Rank 5 · TkA08G169070 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00160Pro_isomerase10-172 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G169070	`PF00160`	Pro_isomerase	10	172	5.6e-37	128.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RWY7`	Arabidopsis thaliana	sp\|Q8RWY7\|CYP95_ARATH Peptidyl-prolyl cis-trans isomerase CYP95	64.300%	Swiss-Prot	Low
`Q9LY75`	Arabidopsis thaliana	sp\|Q9LY75\|CYP63_ARATH Peptidyl-prolyl cis-trans isomerase CYP63	57.700%	Swiss-Prot	Low
`P34790`	Arabidopsis thaliana	sp\|P34790\|CP18C_ARATH Peptidyl-prolyl cis-trans isomerase CYP18-3	52.400%	Swiss-Prot	Low
`Q9SKQ0`	Arabidopsis thaliana	sp\|Q9SKQ0\|CP19B_ARATH Peptidyl-prolyl cis-trans isomerase CYP19-2	42.400%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card