TkA08G168510 | RubberDandelionOmics

Gene overview

TkA08G168510

Reference: TK1151 Chr: Chr08 Coordinates: 44043347-44045406 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1261 bp · TkA08G168510|TK1151|cDNA

GCCCCTCTTTTATCATTTCGTTTGACAGGAGATATATTTCTTTCCACCTCCCTCCTCCCAAATTTCTTCACAATCTTCAGCCTTTTCGTTGTTAATCCGATTGCGGATCGATCAGCTATCGTATACAGAAGAGGAAACAGAAATGGCGGAGAAACATAATATGAAGAATCCATCGGTGAAAAGGATTTTACAGGAGTTGAAAGAGATGCAATCAAACCCATCTGACGATTTCATGAGCCTTCCCCTTGAGGAGAATCTCT...

CDS

Download CDS FASTA

888 bp · TkA08G168510|TK1151|CDS

ATGGCGGAGAAACATAATATGAAGAATCCATCGGTGAAAAGGATTTTACAGGAGTTGAAAGAGATGCAATCAAACCCATCTGACGATTTCATGAGCCTTCCCCTTGAGGAGAATCTCTTTGAATGGCAATTTGCAATTAGGGGTCCAAACGATACAGAGTTTGAAGGAGGAATATATCACGGCAGAATCCAATTGCCTTCAGAGTACCCATTCAAACCACCATCATTTATGTTATTGACGCCAAATGGACGTTTTGAAAC...

Protein

Download Protein FASTA

295 aa · TkA08G168510|TK1151|PROTEIN

MAEKHNMKNPSVKRILQELKEMQSNPSDDFMSLPLEENLFEWQFAIRGPNDTEFEGGIYHGRIQLPSEYPFKPPSFMLLTPNGRFETQTKICLSISNHHPEHWQPSWSVRTALTALIAFMPTSPNGALGSLDYKKEERRVLAVKSRESSPKFGSPDRQKLIDEIHEYMIGKAPPVPQPNLPESAEPPSVDTENSGEAPASPPAEITEPEEQQPEALLNNNTEGDIPRVAEQAALVAPPPVPAVVHHHQQQAAVQKPADDR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G168510`
TK1151 ID	TkA08G168510
OH-1004 ID	LXL04_032344
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 94.268 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G168510

Location Chr08:44043347-44045406 (-)

Description Similar to UBC32: Ubiquitin-conjugating enzyme E2 32

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g17000`	Accepts the ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032344 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000209 protein polyubiquitination Biological Process

GO:0006487 protein N-linked glycosylation Biological Process

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0006513 protein monoubiquitination Biological Process

GO:0007286 spermatid development Biological Process

GO:0032680 regulation of tumor necrosis factor production Biological Process

GO:0036503 ERAD pathway Biological Process

GO:0042631 cellular response to water deprivation Biological Process

GO:1902457 negative regulation of stomatal opening Biological Process

GO:1904153 negative regulation of retrograde protein transport, ER to cytosol Biological Process

GO:0000836 Hrd1p ubiquitin ligase complex Cellular Component

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT3G17000

cgr:2889269

hsa:51465

mmu:56228

sce:YER100W

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.662

Rank 1 · TkA08G168510 · TK1151

Cytoplasm0.184

Rank 2 · TkA08G168510 · TK1151

Nucleus0.172

Rank 3 · TkA08G168510 · TK1151

Golgi apparatus0.168

Rank 4 · TkA08G168510 · TK1151

Cell membrane0.097

Rank 5 · TkA08G168510 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00179UQ_con14-125 aa

PF05773RWD58-98 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G168510	`PF00179`	UQ_con	14	125	2.5e-20	73.2
TkA08G168510	`PF05773`	RWD	58	98	0.14	13.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LSP7`	Arabidopsis thaliana	sp\|Q9LSP7\|UBC32_ARATH Ubiquitin-conjugating enzyme E2 32	61.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card