TkA08G161280 | RubberDandelionOmics

Gene overview

TkA08G161280

Reference: TK1151 Chr: Chr08 Coordinates: 42086837-42087772 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

840 bp · TkA08G161280|TK1151|cDNA

ATGGCTGTTCCCCTCCCTCTTCCGCCCTCCTCCGCCCTCCAGCACCAGCACATCAGCTTCTCCGACCTCCACCGCGTCAACAGAATTGGAAGCGGCAGTGGGGGTACTGTCTACAAAGTCCTCCATCGTCCCACCGATACTCCATTCGCCCTCAAGGTAATCTACGGAACCCACGACGACGATGTCCGCCGCCAGATCCGTCGCGAAATCGAGATCTTACGTGGGGTTGACAACCTAAACGTTGTGAAGTGTCACGACAT...

CDS

Download CDS FASTA

840 bp · TkA08G161280|TK1151|CDS

ATGGCTGTTCCCCTCCCTCTTCCGCCCTCCTCCGCCCTCCAGCACCAGCACATCAGCTTCTCCGACCTCCACCGCGTCAACAGAATTGGAAGCGGCAGTGGGGGTACTGTCTACAAAGTCCTCCATCGTCCCACCGATACTCCATTCGCCCTCAAGGTAATCTACGGAACCCACGACGACGATGTCCGCCGCCAGATCCGTCGCGAAATCGAGATCTTACGTGGGGTTGACAACCTAAACGTTGTGAAGTGTCACGACAT...

Protein

Download Protein FASTA

279 aa · TkA08G161280|TK1151|PROTEIN

MAVPLPLPPSSALQHQHISFSDLHRVNRIGSGSGGTVYKVLHRPTDTPFALKVIYGTHDDDVRRQIRREIEILRGVDNLNVVKCHDMFDRAGEIQVLLEYMDGGCLQGTHLSDELLLADLTRQIISGLYYLHRRKIVHRDIKPSNLLINSKKQVKIADFGVSRILEQTMDPCNSSVGTIAYMSPERINTDLNEGKYNGCAGDIWSVGPPQAPATASREFRDFVGCCLQKDPARRWTAAQLLRHPFVTGGGLNHNRSSFSQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G161280`
TK1151 ID	TkA08G161280
OH-1004 ID	LXL04_032250
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 97.133 / OH-1004 88.852 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G161280

Location Chr08:42086837-42087772 (+)

Description Similar to MKK4: Mitogen-activated protein kinase kinase 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g21220`	Mitogen-activated protein kinase kinase (MAPKK) which regulates abscisic acid (ABA) responses in a MAPKKK20-MKK5-MPK6 cascade involved in root growth (e.g. root cell division and elongation) and stomatal response, probably via MAPK6 activation by protein phosphorylation.	Cell death mediated by MAPK is associated with hydrogen peroxide production in Arabidopsis.2002 · DOI: 10.1074/jbc.m109495200 MAP kinase signalling cascade in Arabidopsis innate immunity.2002 · DOI: 10.1038/415977a Stomatal development and patterning are regulated by environmentally responsive mitogen-activated protein kinases in Arabidopsis.2007 · DOI: 10.1105/tpc.106.048298 Ethylene signaling is required for the acceleration of cell death induced by the activation of AtMEK5 in Arabidopsis.2008 · DOI: 10.1038/cr.2008.29 Regulation of floral organ abscission in Arabidopsis thaliana.2008 · DOI: 10.1073/pnas.0805539105 A Pseudomonas syringae ADP-ribosyltransferase inhibits Arabidopsis mitogen-activated protein kinase kinases.2010 · DOI: 10.1105/tpc.110.075697 A MAPK cascade downstream of ERECTA receptor-like protein kinase regulates Arabidopsis inflorescence architecture by promoting localized cell proliferation.2012 · DOI: 10.1105/tpc.112.104695 Brassinosteroid-regulated GSK3/Shaggy-like kinases phosphorylate mitogen-activated protein (MAP) kinase kinases, which control stomata development in Arabidopsis thaliana.2013 · DOI: 10.1074/jbc.m112.384453 MKK5 regulates high light-induced gene expression of Cu/Zn superoxide dismutase 1 and 2 in Arabidopsis.2013 · DOI: 10.1093/pcp/pct072 Identification of BZR1-interacting proteins as potential components of the brassinosteroid signaling pathway in Arabidopsis through tandem affinity purification.2013 · DOI: 10.1074/mcp.m113.029256 AIK1, A Mitogen-Activated Protein Kinase, Modulates Abscisic Acid Responses through the MKK5-MPK6 Kinase Cascade.2017 · DOI: 10.1104/pp.16.01386
`At1g51660`	Involved in the second phase of hydrogen peroxide generation during hypersensitive response-like cell death.	MAP kinase signalling cascade in Arabidopsis innate immunity.2002 · DOI: 10.1038/415977a Stomatal development and patterning are regulated by environmentally responsive mitogen-activated protein kinases in Arabidopsis.2007 · DOI: 10.1105/tpc.106.048298 Regulation of floral organ abscission in Arabidopsis thaliana.2008 · DOI: 10.1073/pnas.0805539105 Arabidopsis MKK4 mediates osmotic-stress response via its regulation of MPK3 activity.2011 · DOI: 10.1016/j.bbrc.2011.07.064 A MAPK cascade downstream of ERECTA receptor-like protein kinase regulates Arabidopsis inflorescence architecture by promoting localized cell proliferation.2012 · DOI: 10.1105/tpc.112.104695 Brassinosteroid-regulated GSK3/Shaggy-like kinases phosphorylate mitogen-activated protein (MAP) kinase kinases, which control stomata development in Arabidopsis thaliana.2013 · DOI: 10.1074/jbc.m112.384453
`At1g73500`	MKK9-MPK3/MPK6 module phosphorylates and activates EIN3, leading to the promotion of EIN3-mediated transcription in ethylene signaling.	Dual control of nuclear EIN3 by bifurcate MAPK cascades in C2H4 signalling.2008 · DOI: 10.1038/nature06543 Activation of MAPK kinase 9 induces ethylene and camalexin biosynthesis and enhances sensitivity to salt stress in Arabidopsis.2008 · DOI: 10.1074/jbc.m801392200 An arabidopsis mitogen-activated protein kinase cascade, MKK9-MPK6, plays a role in leaf senescence.2009 · DOI: 10.1104/pp.108.133439
`At1g18350`	May function as a negative regulator of polar auxin transport.	Increased expression of MAP KINASE KINASE7 causes deficiency in polar auxin transport and leads to plant architectural abnormality in Arabidopsis.2006 · DOI: 10.1105/tpc.105.037846 Overexpression of Arabidopsis MAP kinase kinase 7 leads to activation of plant basal and systemic acquired resistance.2007 · DOI: 10.1111/j.1365-313x.2007.03294.x
`At3g06230`	Mitogen-activated protein kinase kinase 8.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032250 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000165 MAPK cascade Biological Process

GO:0002229 defense response to oomycetes Biological Process

GO:0007165 signal transduction Biological Process

GO:0009611 response to wounding Biological Process

GO:0009620 response to fungus Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009693 ethylene biosynthetic process Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009862 systemic acquired resistance, salicylic acid mediated signaling pathway Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0009875 pollen-pistil interaction Biological Process

KEGG gene cross-reference

ath:AT1G18350

ath:AT1G51660

ath:AT1G73500

ath:AT3G06230

ath:AT3G21220

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.563

Rank 1 · TkA08G161280 · TK1151

Cytoplasm0.550

Rank 2 · TkA08G161280 · TK1151

Cell membrane0.084

Rank 3 · TkA08G161280 · TK1151

Endoplasmic reticulum0.046

Rank 4 · TkA08G161280 · TK1151

Mitochondrion0.042

Rank 5 · TkA08G161280 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13095FTA218-64 aa

PF14531Kinase-like23-64 aa

PF00069Pkinase24-207 aa

PF07714PK_Tyr_Ser-Thr25-207 aa

PF01636APH27-120 aa

PF03109ABC128-76 aa

PF17667Pkinase_fungal64-78 aa

PF03109ABC197-167 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G161280	`PF13095`	FTA2	18	64	0.041	14.3
TkA08G161280	`PF14531`	Kinase-like	23	64	0.0048	16.9
TkA08G161280	`PF00069`	Pkinase	24	207	2.3e-55	188.6
TkA08G161280	`PF07714`	PK_Tyr_Ser-Thr	25	207	4.4e-30	105.6
TkA08G161280	`PF01636`	APH	27	120	0.0093	16.5
TkA08G161280	`PF03109`	ABC1	28	76	7.8e-06	25.9
TkA08G161280	`PF17667`	Pkinase_fungal	64	78	0.00015	21.4
TkA08G161280	`PF03109`	ABC1	97	167	7.8e-06	25.9
TkA08G161280	`PF10707`	YrbL-PhoP_reg	111	152	0.069	13.5
TkA08G161280	`PF01636`	APH	117	154	0.0093	16.5
TkA08G161280	`PF14531`	Kinase-like	119	160	0.0048	16.9
TkA08G161280	`PF17667`	Pkinase_fungal	121	188	0.00015	21.4
TkA08G161280	`PF13095`	FTA2	121	149	0.041	14.3
TkA08G161280	`PF12330`	Haspin_kinase	136	166	0.026	14.3
TkA08G161280	`PF07714`	PK_Tyr_Ser-Thr	210	242	4.4e-30	105.6
TkA08G161280	`PF00069`	Pkinase	212	246	2.3e-55	188.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RXG3`	Arabidopsis thaliana	sp\|Q8RXG3\|M2K5_ARATH Mitogen-activated protein kinase kinase 5	67.700%	Swiss-Prot	High
`O80397`	Arabidopsis thaliana	sp\|O80397\|M2K4_ARATH Mitogen-activated protein kinase kinase 4	57.700%	Swiss-Prot	High
`Q9FX43`	Arabidopsis thaliana	sp\|Q9FX43\|M2K9_ARATH Mitogen-activated protein kinase kinase 9	48.300%	Swiss-Prot	Medium
`Q9LPQ3`	Arabidopsis thaliana	sp\|Q9LPQ3\|M2K7_ARATH Mitogen-activated protein kinase kinase 7	46.000%	Swiss-Prot	Medium
`Q9M8J5`	Arabidopsis thaliana	sp\|Q9M8J5\|M2K8_ARATH Mitogen-activated protein kinase kinase 8	44.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card