TkA08G160800 | RubberDandelionOmics

Gene overview

TkA08G160800

Reference: TK1151 Chr: Chr08 Coordinates: 41962130-41963767 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1509 bp · TkA08G160800|TK1151|cDNA

ATGGAAAAGCAGCAGCTTCTGGAAATGGGTTTCTCCGACGAGTTAGTTTCTCAAGCTCTCTCCGCCACCGTCGGCAAACCCATTTCCAGTGCCACCGAATGGATTCTCAGCCAAGAATCTAAAACCGACAACAAAAAATCCCCACCAGAACCCAAAAAAAGAAAGCAGCATCCCGCTTGCAACGAACAACCGCTGGCTGAGCGTATGCGGCCTCACACCATCTCCCAAATCGTAGGGCAAGACCACCTCCTCGCGGATAA...

CDS

Download CDS FASTA

1509 bp · TkA08G160800|TK1151|CDS

ATGGAAAAGCAGCAGCTTCTGGAAATGGGTTTCTCCGACGAGTTAGTTTCTCAAGCTCTCTCCGCCACCGTCGGCAAACCCATTTCCAGTGCCACCGAATGGATTCTCAGCCAAGAATCTAAAACCGACAACAAAAAATCCCCACCAGAACCCAAAAAAAGAAAGCAGCATCCCGCTTGCAACGAACAACCGCTGGCTGAGCGTATGCGGCCTCACACCATCTCCCAAATCGTAGGGCAAGACCACCTCCTCGCGGATAA...

Protein

Download Protein FASTA

502 aa · TkA08G160800|TK1151|PROTEIN

MEKQQLLEMGFSDELVSQALSATVGKPISSATEWILSQESKTDNKKSPPEPKKRKQHPACNEQPLAERMRPHTISQIVGQDHLLADKSSILRSAIDRDRLPSLILWGPPGTGKTSIGRAIVNSCSSSSSYRFVTLSAVTAGVKDVRDVVDEARKRKKNSINGTITRTVLFVDEVHRFNKSQLDSFLPVIEDGSIIFIGATTENPSFHLITPLLSRCRVLTLSSLQPHHVSTILKRATDDSNIGLPQSVGRAINVSDEVIE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G160800`
TK1151 ID	TkA08G160800
OH-1004 ID	LXL04_032241
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	90.100
Protein coverage (%)	TK1151 96.414 / OH-1004 98.138 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G160800`
Location	Chr08:41962130-41963767 (-)
Description	Similar to Wrnip1: ATPase WRNIP1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_032241` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000731 DNA synthesis involved in DNA repair Biological Process GO:0006261 DNA-templated DNA replication Biological Process GO:0030174 regulation of DNA-templated DNA replication initiation Biological Process GO:0045087 innate immune response Biological Process GO:0070914 UV-damage excision repair Biological Process GO:1902983 DNA strand elongation involved in mitotic DNA replication Biological Process GO:1903461 Okazaki fragment processing involved in mitotic DNA replication Biological Process GO:0000781 chromosome, telomeric region Cellular Component GO:0005634 nucleus Cellular Component GO:0016020 membrane Cellular Component GO:0048471 perinuclear region of cytoplasm Cellular Component GO:0003677 DNA binding Molecular Function
KEGG gene cross-reference	hin:HI_1590 hsa:56897 mmu:78903 rno:282835 spo:2542096 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.595

Rank 1 · TkA08G160800 · TK1151

Cytoplasm0.490

Rank 2 · TkA08G160800 · TK1151

Mitochondrion0.078

Rank 3 · TkA08G160800 · TK1151

Peroxisome0.042

Rank 4 · TkA08G160800 · TK1151

Plastid0.025

Rank 5 · TkA08G160800 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22562UBA_74-39 aa

PF00627UBA4-28 aa

PF24899UBA_DHX295-34 aa

PF05496RuvB_N69-201 aa

PF05673DUF81574-159 aa

PF06068TIP4977-137 aa

PF00158Sigma54_activat80-203 aa

PF13191AAA_1690-151 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G160800	`PF22562`	UBA_7	4	39	3.9e-07	30.6
TkA08G160800	`PF00627`	UBA	4	28	0.00033	21.1
TkA08G160800	`PF24899`	UBA_DHX29	5	34	0.21	12.1
TkA08G160800	`PF05496`	RuvB_N	69	201	1.1e-09	39.0
TkA08G160800	`PF05673`	DUF815	74	159	0.0023	17.9
TkA08G160800	`PF06068`	TIP49	77	137	0.009	15.9
TkA08G160800	`PF00158`	Sigma54_activat	80	203	0.00066	20.1
TkA08G160800	`PF13191`	AAA_16	90	151	2e-05	25.9
TkA08G160800	`PF20693`	YobI-ATPase	90	184	0.074	13.3
TkA08G160800	`PF01637`	ATPase_2	92	130	0.041	14.4
TkA08G160800	`PF13086`	AAA_11	92	124	0.072	13.6
TkA08G160800	`PF05621`	TniB	93	118	0.21	11.7
TkA08G160800	`PF00308`	Bac_DnaA	97	180	0.048	14.6
TkA08G160800	`PF13401`	AAA_22	102	178	5.2e-05	24.3
TkA08G160800	`PF13245`	AAA_19	102	149	0.00025	21.9
TkA08G160800	`PF04851`	ResIII	102	136	0.0021	18.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card