TkA08G160080 | RubberDandelionOmics

Gene overview

TkA08G160080

Reference: TK1151 Chr: Chr08 Coordinates: 41761125-41764019 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1851 bp · TkA08G160080|TK1151|cDNA

ATGCAGACGTTTCAACTTTTGCATCTACTCATCTTCATTTCGCTAACAACACCATTAATCGAAGCTCAGATTTTCTTCAGCAAACCACGATGTAGTACAAGATGTGGGCAGGTCTTAATTGGCTACCCTTTCGGAATCGGAAGCAATTGTTCAGCCAACGATTGCAATGTCGAAATGTTAGGTTTAAACATGTTCGCACAAACAGTGACAATCAACATTTCCGTAATTAAAGTCGATTGCAAGAATCCAGTCCTAGACAG...

CDS

Download CDS FASTA

1851 bp · TkA08G160080|TK1151|CDS

ATGCAGACGTTTCAACTTTTGCATCTACTCATCTTCATTTCGCTAACAACACCATTAATCGAAGCTCAGATTTTCTTCAGCAAACCACGATGTAGTACAAGATGTGGGCAGGTCTTAATTGGCTACCCTTTCGGAATCGGAAGCAATTGTTCAGCCAACGATTGCAATGTCGAAATGTTAGGTTTAAACATGTTCGCACAAACAGTGACAATCAACATTTCCGTAATTAAAGTCGATTGCAAGAATCCAGTCCTAGACAG...

Protein

Download Protein FASTA

616 aa · TkA08G160080|TK1151|PROTEIN

MQTFQLLHLLIFISLTTPLIEAQIFFSKPRCSTRCGQVLIGYPFGIGSNCSANDCNVEMLGLNMFAQTVTINISVIKVDCKNPVLDSNLILGASYSRSPFTISGSNNSLVVKGCGNGVLIENRTIVGGCSTTCGNQNDIVDDENNCFGVGCCQTAIPHDLKSFTLNLTGLEAQNRERLSLTRIPGQIIGDDYDFAPISLSWNESFNLDSTRCNETCGEFSIPYPFGIERNCSKSDWFNVDCNSSTPFLPAFNNLEVLDFG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G160080`
TK1151 ID	TkA08G160080
OH-1004 ID	LXL04_032227
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	71.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G160080

Location Chr08:41761125-41764019 (+)

Description Similar to WAKL2: Wall-associated receptor kinase-like 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g16130`	Serine/threonine-protein kinase that may function as a signaling receptor of extracellular matrix component.	No verified direct reference in this release
`At1g16120`	Serine/threonine-protein kinase that may function as a signaling receptor of extracellular matrix component.	No verified direct reference in this release
`At1g16260`	Serine/threonine-protein kinase that may function as a signaling receptor of extracellular matrix component.	No verified direct reference in this release
`At1g16140`	Serine/threonine-protein kinase that may function as a signaling receptor of extracellular matrix component.	No verified direct reference in this release
`At1g79670`	Serine/threonine-protein kinase that may function as a signaling receptor of extracellular matrix component.	RESISTANCE TO FUSARIUM OXYSPORUM 1, a dominant Arabidopsis disease-resistance gene, is not race specific.2005 · DOI: 10.1534/genetics.105.042218

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032227 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0007166 cell surface receptor signaling pathway Biological Process

GO:0009620 response to fungus Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005509 calcium ion binding Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0030247 polysaccharide binding Molecular Function

KEGG gene cross-reference

ath:AT1G16130

ath:AT1G16260

ath:AT1G79670

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.837

Rank 1 · TkA08G160080 · TK1151

Cytoplasm0.080

Rank 2 · TkA08G160080 · TK1151

Endoplasmic reticulum0.075

Rank 3 · TkA08G160080 · TK1151

Nucleus0.058

Rank 4 · TkA08G160080 · TK1151

Lysosome / Vacuole0.025

Rank 5 · TkA08G160080 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13947GUB_WAK_bind31-58 aa

PF13947GUB_WAK_bind129-137 aa

PF13947GUB_WAK_bind212-268 aa

PF00069Pkinase413-495 aa

PF07714PK_Tyr_Ser-Thr415-490 aa

PF07714PK_Tyr_Ser-Thr492-507 aa

PF07714PK_Tyr_Ser-Thr553-576 aa

PF00069Pkinase554-574 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G160080	`PF13947`	GUB_WAK_bind	31	58	9.3e-13	49.1
TkA08G160080	`PF13947`	GUB_WAK_bind	129	137	9.3e-13	49.1
TkA08G160080	`PF13947`	GUB_WAK_bind	212	268	9.3e-13	49.1
TkA08G160080	`PF00069`	Pkinase	413	495	3.4e-13	50.3
TkA08G160080	`PF07714`	PK_Tyr_Ser-Thr	415	490	1.4e-13	51.4
TkA08G160080	`PF07714`	PK_Tyr_Ser-Thr	492	507	1.4e-13	51.4
TkA08G160080	`PF07714`	PK_Tyr_Ser-Thr	553	576	1.4e-13	51.4
TkA08G160080	`PF00069`	Pkinase	554	574	3.4e-13	50.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q7X8C5`	Arabidopsis thaliana	sp\|Q7X8C5\|WAKLB_ARATH Wall-associated receptor kinase-like 2	32.300%	Swiss-Prot	Medium
`Q9S9M5`	Arabidopsis thaliana	sp\|Q9S9M5\|WAKLA_ARATH Wall-associated receptor kinase-like 1	31.200%	Swiss-Prot	Medium
`Q9SA25`	Arabidopsis thaliana	sp\|Q9SA25\|WAKLG_ARATH Wall-associated receptor kinase-like 8	29.600%	Swiss-Prot	Low
`Q9S9M3`	Arabidopsis thaliana	sp\|Q9S9M3\|WAKLC_ARATH Wall-associated receptor kinase-like 3	30.800%	Swiss-Prot	Medium
`Q8RY17`	Arabidopsis thaliana	sp\|Q8RY17\|WAKLI_ARATH Wall-associated receptor kinase-like 22	30.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card