TkA08G158060 | RubberDandelionOmics

Gene overview

TkA08G158060

Reference: TK1151 Chr: Chr08 Coordinates: 41128033-41130202 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1112 bp · TkA08G158060|TK1151|cDNA

TTGATATCAAAGTTTCCTTTTGCATACGTAGTGTCACGTGGAGCGCACGTGAGTAATGTACCCACATTTTATGAAGTTCGTCTTGATTTCACGGAAGCTAGGGTTTTAGGACAGGTCTTCCGATTGAGGTTTCCGGTTCCGACGATGGCGATTCCACATCCGTACGATCCAGTATATTACAACATTCCGTCGATTCCTCCATTGGAGTATGCCGGTTACGACGACCCCAACGCCATTAATACACTCTTCGTTTCGGGCTT...

CDS

Download CDS FASTA

981 bp · TkA08G158060|TK1151|CDS

TTGATATCAAAGTTTCCTTTTGCATACGTAGTGTCACGTGGAGCGCACGTGAGTAATGTACCCACATTTTATGAAGTTCGTCTTGATTTCACGGAAGCTAGGGTTTTAGGACAGGTCTTCCGATTGAGGTTTCCGGTTCCGACGATGGCGATTCCACATCCGTACGATCCAGTATATTACAACATTCCGTCGATTCCTCCATTGGAGTATGCCGGTTACGACGACCCCAACGCCATTAATACACTCTTCGTTTCGGGCTT...

Protein

Download Protein FASTA

326 aa · TkA08G158060|TK1151|PROTEIN

LISKFPFAYVVSRGAHVSNVPTFYEVRLDFTEARVLGQVFRLRFPVPTMAIPHPYDPVYYNIPSIPPLEYAGYDDPNAINTLFVSGLPDDIKAREIHNLFRRRPGFDHCQLKYTGRGNQVVAFATFVNHPSAIAALRDLNGVKFDPQTGSTLHIELARSNSRRKPKPGPEAYVVIDKRSIATKDDQDSSDDVAFSGDSETEEQSEADKDNAVTTKSDEETAGDLDSTVAAENDQTENTVDGACSTLFIANLGPNCTEDEL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G158060`
TK1151 ID	TkA08G158060
OH-1004 ID	LXL04_032181
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	95.100
Protein coverage (%)	TK1151 93.252 / OH-1004 99.010 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G158060`
Location	Chr08:41128033-41130202 (+)
Description	Similar to rbpms2: RNA-binding protein with multiple splicing 2
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_032181` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000381 regulation of alternative mRNA splicing, via spliceosome Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006396 RNA processing Biological Process GO:0006979 response to oxidative stress Biological Process GO:0046660 female sex differentiation Biological Process GO:0048661 positive regulation of smooth muscle cell proliferation Biological Process GO:0060047 heart contraction Biological Process GO:0060395 SMAD protein signal transduction Biological Process GO:0065003 protein-containing complex assembly Biological Process GO:0000932 P-body Cellular Component GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component
KEGG gene cross-reference	dre:436682 gga:395678 hsa:11030 rno:498642 xla:398092 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.608

Rank 1 · TkA08G158060 · TK1151

Cytoplasm0.469

Rank 2 · TkA08G158060 · TK1151

Cell membrane0.054

Rank 3 · TkA08G158060 · TK1151

Endoplasmic reticulum0.037

Rank 4 · TkA08G158060 · TK1151

Mitochondrion0.036

Rank 5 · TkA08G158060 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF28978RRM_SRRT81-111 aa

PF00076RRM_182-145 aa

PF26763Whi3-like_N82-160 aa

PF28976RRM_ACIN1122-155 aa

PF28978RRM_SRRT244-274 aa

PF00076RRM_1246-308 aa

PF28976RRM_ACIN1284-318 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G158060	`PF28978`	RRM_SRRT	81	111	0.0011	19.8
TkA08G158060	`PF00076`	RRM_1	82	145	3.6e-20	72.3
TkA08G158060	`PF26763`	Whi3-like_N	82	160	0.0016	19.4
TkA08G158060	`PF28976`	RRM_ACIN1	122	155	4.4e-05	24.2
TkA08G158060	`PF28978`	RRM_SRRT	244	274	0.0011	19.8
TkA08G158060	`PF00076`	RRM_1	246	308	3.6e-20	72.3
TkA08G158060	`PF28976`	RRM_ACIN1	284	318	4.4e-05	24.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card