TkA08G158030 | RubberDandelionOmics

Gene overview

TkA08G158030

Reference: TK1151 Chr: Chr08 Coordinates: 41108116-41114678 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2662 bp · TkA08G158030|TK1151|cDNA

AACATGAAAGACATTGGAAAAAAAACTATTCAGTCAACCAGGTTAGACACTAACCCTTATTTTTTTAGCGAACTCGCACCACGGCCTTTCCTAACCGACGAGCCTCCTCCGCAAGTAGAAGCAAGAAAACACAACCCAAATATATCAGAAAATATCTAAAAGCCGATCGGCTCTCCTATCATCTTCAAGAAGATAAAATGGCAGGAAGAAACCGATATCCACGTGATGCATATGAGAATCATCGCGGGTACCCTCCAGAA...

CDS

Download CDS FASTA

837 bp · TkA08G158030|TK1151|CDS

ATGGCAGGAAGAAACCGATATCCACGTGATGCATATGAGAATCATCGCGGGTACCCTCCAGAAGTTCCTCCATCCCGTGCCCCCATGCCTAGAGCCATGCCACCTCACCCCATAATGCTTGAAGAAGAACTTGAAATACAACACCATGAAATCCGCAGGCTTTTGGGTGAAAACAGAAGGTTAGTTGATGACCGAATTGCCCTCCAACAAGACTTAGGTGCAGCAAGAGAAGAACTCAGGCGAATGAACATTGCAATGAA...

Protein

Download Protein FASTA

278 aa · TkA08G158030|TK1151|PROTEIN

MAGRNRYPRDAYENHRGYPPEVPPSRAPMPRAMPPHPIMLEEELEIQHHEIRRLLGENRRLVDDRIALQQDLGAAREELRRMNIAMNDIQAENEMHSRQLIDRGLKLEADLRATEPLKKEVAQLHGEVERLNSIRHDLSGQVQTLTKDLVKLQAENKQLSALRAEAEGLHKELMHARVAIDYEKKASIELMDQKQSMEKNLVSMAREVEKLRAELTNSDSRSWGAGGPYRMNYGTSDGNFPRAYGDPYGGHPLGENGPMY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G158030`
TK1151 ID	TkA08G158030
OH-1004 ID	LXL04_032183
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G158030

Location Chr08:41108116-41114678 (+)

Description Similar to FLXL3: Protein FLX-like 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g55170`	Has no transcriptional activation activity.	No verified direct reference in this release
`At1g67170`	Has no transcriptional activation activity.	No verified direct reference in this release
`At3g14750`	Has no transcriptional activation activity.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032183 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0009908 flower development Biological Process

GO:0030154 cell differentiation Biological Process

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016604 nuclear body Cellular Component

KEGG gene cross-reference

ath:AT1G55170

ath:AT1G67170

ath:AT2G30120

ath:AT3G14750

ath:AT5G61920

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.639

Rank 1 · TkA08G158030 · TK1151

Nucleus0.385

Rank 2 · TkA08G158030 · TK1151

Cell membrane0.102

Rank 3 · TkA08G158030 · TK1151

Endoplasmic reticulum0.036

Rank 4 · TkA08G158030 · TK1151

Lysosome / Vacuole0.023

Rank 5 · TkA08G158030 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07989Cnn_1N39-84 aa

PF26666DUF822139-61 aa

PF01763Herpes_UL639-103 aa

PF25541TBCA_PH40-138 aa

PF14662KASH_CCD40-83 aa

PF23649FKBP1540-99 aa

PF04977DivIC40-78 aa

PF28934CCDC16040-64 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G158030	`PF07989`	Cnn_1N	39	84	1.0	10.3
TkA08G158030	`PF26666`	DUF8221	39	61	1.3	9.9
TkA08G158030	`PF01763`	Herpes_UL6	39	103	2.0	7.5
TkA08G158030	`PF25541`	TBCA_PH	40	138	0.03	14.7
TkA08G158030	`PF14662`	KASH_CCD	40	83	0.057	14.1
TkA08G158030	`PF23649`	FKBP15	40	99	0.21	11.9
TkA08G158030	`PF04977`	DivIC	40	78	0.71	10.4
TkA08G158030	`PF28934`	CCDC160	40	64	1.6	9.2
TkA08G158030	`PF17675`	APG6_N	40	102	3.2	8.9
TkA08G158030	`PF11559`	ADIP	40	95	3.9	8.3
TkA08G158030	`PF08614`	ATG16	40	99	4.1	8.3
TkA08G158030	`PF16515`	HIP1_clath_bdg	41	100	0.85	10.7
TkA08G158030	`PF24611`	Spectrin_Anc-1	41	90	2.1	9.4
TkA08G158030	`PF30677`	CCDC18_1st	41	129	6.0	6.8
TkA08G158030	`PF06818`	Fez1	42	130	0.039	15.1
TkA08G158030	`PF30102`	YonD_C	42	106	0.099	13.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C717`	Arabidopsis thaliana	sp\|Q9C717\|FLXL3_ARATH Protein FLX-like 3	41.700%	Swiss-Prot	Medium
`Q84TD8`	Arabidopsis thaliana	sp\|Q84TD8\|FLXL2_ARATH Protein FLX-like 2	30.500%	Swiss-Prot	Medium
`Q93V84`	Arabidopsis thaliana	sp\|Q93V84\|FLXL1_ARATH Protein FLX-like 1	30.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card