TkA08G139570 | RubberDandelionOmics

Gene overview

TkA08G139570

Reference: TK1151 Chr: Chr08 Coordinates: 36288501-36290242 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1415 bp · TkA08G139570|TK1151|cDNA

AAATAATGTTGAGGTTATTAAAAGAGGGTGATTAGGTTTTTTTACAAAAGGAATTGGATTTAGAAGAAAAAGAAAGGTTTACAAATTACAATCACCTTCTTCTGCAATTGGGGGTTGCATTGCGATTCATCATTGATCGTTGAATCAATGAATCGTCGGTAGATTCTACAATTTACGTGCTTTGCGATTATACATTCGACCCTTGTGACGTTGTGGATCCAAGTGGCTACAAAATTGCCACGGTGCTTTACCTTTGTTCA...

CDS

Download CDS FASTA

573 bp · TkA08G139570|TK1151|CDS

ATGGCGAATCTTAGAAGAACTGTGTTGTTTGGCATATCACGATTCCTTAATTCAACAGCCGCCCCCGCTCGTGTACTCGCCGGCGCATCGTCAAACGTCACCGTTCCGTATCAAACTCTCTACAGGCCTTGTGTTAATTCCTTCTCTCGGTTCTATTCTTCAAATAACAGTACCGAATCGTTAGATTTCGATTTGTCCAATGAAGAAAGCAAGCGACAACTAGTGAACAGATTGATGTATAGAAGTAAACAAAGGGGTTT...

Protein

Download Protein FASTA

190 aa · TkA08G139570|TK1151|PROTEIN

MANLRRTVLFGISRFLNSTAAPARVLAGASSNVTVPYQTLYRPCVNSFSRFYSSNNSTESLDFDLSNEESKRQLVNRLMYRSKQRGFLELDLVLGSWVENHIESLDEKGIKSLIAVLDLENPDLWKWLTGQETPPESIDTNPVFNEVRSKVMNNLDSYASPHTRATPGQPWVRGWDDFQKGRDSPIVGNQ

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G139570`
TK1151 ID	TkA08G139570
OH-1004 ID	LXL04_020615
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	52.900
Protein coverage (%)	TK1151 62.632 / OH-1004 30.841 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G139570

Location Chr08:36288501-36290242 (-)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g51040`	May participate in succinate dehydrogenase complex assembly, supporting the TCA cycle and mitochondrial electron transport.	Succinate dehydrogenase assembly factor 2 is needed for assembly and activity of mitochondrial complex II and for normal root elongation in Arabidopsis.2013 · DOI: 10.1111/tpj.12041

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020615 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source) No functional description available

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.892

Rank 1 · TkA08G139570 · TK1151

Plastid0.061

Rank 2 · TkA08G139570 · TK1151

Cytoplasm0.060

Rank 3 · TkA08G139570 · TK1151

Nucleus0.052

Rank 4 · TkA08G139570 · TK1151

Cell membrane0.012

Rank 5 · TkA08G139570 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16797Fungal_KA146-79 aa

PF03937Sdh576-149 aa

PF16797Fungal_KA1136-156 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G139570	`PF16797`	Fungal_KA1	46	79	0.28	11.6
TkA08G139570	`PF03937`	Sdh5	76	149	9.2e-23	80.7
TkA08G139570	`PF16797`	Fungal_KA1	136	156	0.28	11.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FI44`	Arabidopsis thaliana	sp\|Q9FI44\|SDAF2_ARATH Succinate dehydrogenase assembly factor 2, mitochondrial	56.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card