TkA08G132720 | RubberDandelionOmics

Gene overview

TkA08G132720

Reference: TK1151 Chr: Chr08 Coordinates: 34476385-34479771 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2268 bp · TkA08G132720|TK1151|cDNA

GAGCAAGATGAATTTGTGACAGTGATCAACTTTGGTCCTTGTATATTATCTGGCGATTTTATCCACAACCACCAACATTTGCAACTCCCACTCTCCACAAACCCTAGAATTTTTTCTCCCAGAAGAAGGCGAAGAAGAAGAAGAACAGAAGATAGTGTACAAGTGCGAGGAAGATATGGCGGTTGCGAACGCTTATTGGGCTACAGGAACTTCAGTCCCAAATATCCCCCAAATCCGACCTCCTATATCTTCTTCTTTCG...

CDS

Download CDS FASTA

1923 bp · TkA08G132720|TK1151|CDS

ATGGCGGTTGCGAACGCTTATTGGGCTACAGGAACTTCAGTCCCAAATATCCCCCAAATCCGACCTCCTATATCTTCTTCTTTCGATTTGTCTGTTGCCAAGAAATATATTAATCTGAGGTTCGTATCGGGTTCGTGTAATGGTCCCAAACCGTCGCCAATTCTTACCCGTTGCCGTTGTAGCAGCAACACCACTAATTCCGATCATGCCACCTCTTCGGATTGGGATTGGAATACGTGGACTCGCCATTTCTCCGAAAT...

Protein

Download Protein FASTA

640 aa · TkA08G132720|TK1151|PROTEIN

MAVANAYWATGTSVPNIPQIRPPISSSFDLSVAKKYINLRFVSGSCNGPKPSPILTRCRCSSNTTNSDHATSSDWDWNTWTRHFSEIELAERSVSLLQFQLEEAIEKEDFQEASKLKRAIAEATSKDSVAEVMSELKTAIHEERYHDASRLCKNTGSGLVGWWVGYSKDSDDPFGRLIRITPGVGRFIGRSYNPRQLVSASPGTPLFEIFVNKETDNTYTMKVVFMQRAKSNNLKATSPSMKGASMADIENPSVIDVKVN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G132720`
TK1151 ID	TkA08G132720
OH-1004 ID	LXL04_031853
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 93.023 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G132720

Location Chr08:34476385-34479771 (+)

Description Similar to EX2: Protein EXECUTER 2, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g27510`	Together with EX1, enables higher plants to perceive singlet oxygen as a stress signal in plastid that activates a genetically determined nuclear stress response program which triggers a programmed cell death (PCD).	No verified direct reference in this release
`At4g33630`	Together with EX2, enables higher plants to perceive singlet oxygen as a stress signal in plastid that activates a genetically determined nuclear stress response program which triggers a programmed cell death (PCD).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0107900`	Together with EX1, enables higher plants to perceive singlet oxygen as a stress signal in plastid that activates a genetically determined nuclear stress response program which triggers a programmed cell death (PCD).	No verified direct reference in this release
`Os10g0485300`	Together with EX2, enables higher plants to perceive singlet oxygen as a stress signal in plastid that activates a genetically determined nuclear stress response program which triggers a programmed cell death (PCD).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031853 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000304 response to singlet oxygen Biological Process

GO:0010343 singlet oxygen-mediated programmed cell death Biological Process

GO:0009507 chloroplast Cellular Component

GO:0009579 thylakoid Cellular Component

GO:0042651 thylakoid membrane Cellular Component

KEGG gene cross-reference

ath:AT1G27510

ath:AT4G33630

dosa:Os01g0107900

dosa:Os10g0485300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.954

Rank 1 · TkA08G132720 · TK1151

Nucleus0.057

Rank 2 · TkA08G132720 · TK1151

Cytoplasm0.039

Rank 3 · TkA08G132720 · TK1151

Mitochondrion0.039

Rank 4 · TkA08G132720 · TK1151

Cell membrane0.022

Rank 5 · TkA08G132720 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29231DUF851788-127 aa

PF02151UVR92-117 aa

PF29231DUF8517122-153 aa

PF02151UVR128-151 aa

PF23798Beta-prop_SPT8256-362 aa

PF12014Cyclin_D1_bind486-638 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G132720	`PF29231`	DUF8517	88	127	0.00028	21.5
TkA08G132720	`PF02151`	UVR	92	117	0.0019	18.6
TkA08G132720	`PF29231`	DUF8517	122	153	0.00028	21.5
TkA08G132720	`PF02151`	UVR	128	151	0.0019	18.6
TkA08G132720	`PF23798`	Beta-prop_SPT8	256	362	0.87	9.1
TkA08G132720	`PF12014`	Cyclin_D1_bind	486	638	5.1e-30	105.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94AT5`	Arabidopsis thaliana	sp\|Q94AT5\|EXEC2_ARATH Protein EXECUTER 2, chloroplastic	54.600%	Swiss-Prot	High
`Q93YW0`	Arabidopsis thaliana	sp\|Q93YW0\|EXEC1_ARATH Protein EXECUTER 1, chloroplastic	35.900%	Swiss-Prot	Medium
`Q657X6`	Oryza sativa subsp. japonica	sp\|Q657X6\|EXEC2_ORYSJ Protein EXECUTER 2, chloroplastic	53.300%	Swiss-Prot	High
`Q7XD99`	Oryza sativa subsp. japonica	sp\|Q7XD99\|EXEC1_ORYSJ Protein EXECUTER 1, chloroplastic	33.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card