TkA08G131270 | RubberDandelionOmics

Gene overview

TkA08G131270

Reference: TK1151 Chr: Chr08 Coordinates: 34080985-34082582 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1505 bp · TkA08G131270|TK1151|cDNA

AACCACATGTGGTGTTCATACCGTTTCCAGCACAAAGCCACATCAAGTGCATGCTCAAACTAGCAAGGCTCCTGCACCACAAGGGTCTGGACATAACCTTCGTCAACACAGAGTCAAACCACAAGCGCCTTTTAAAGTACGGTGGGTTTCACGATCTTGACGATGTGCCTGGTTTTCAATTCAAATCGGTTCCAGACGGCCTCTCTTCCACTTTTGACAGCGAGCATGGACCAACTCAGACCATCGTTGAAATCGCCAGT...

CDS

Download CDS FASTA

1365 bp · TkA08G131270|TK1151|CDS

ATGCTCAAACTAGCAAGGCTCCTGCACCACAAGGGTCTGGACATAACCTTCGTCAACACAGAGTCAAACCACAAGCGCCTTTTAAAGTACGGTGGGTTTCACGATCTTGACGATGTGCCTGGTTTTCAATTCAAATCGGTTCCAGACGGCCTCTCTTCCACTTTTGACAGCGAGCATGGACCAACTCAGACCATCGTTGAAATCGCCAGTTACCTTGGCACCAATTTCTTGGCCGACTTTCTTGAAATTGTAGCCGGACT...

Protein

Download Protein FASTA

454 aa · TkA08G131270|TK1151|PROTEIN

MLKLARLLHHKGLDITFVNTESNHKRLLKYGGFHDLDDVPGFQFKSVPDGLSSTFDSEHGPTQTIVEIASYLGTNFLADFLEIVAGLQTPVTCIISDGFMTFAQTPHAAEKLGVPFILFWTMAACGFMGFYQAKVLTEKGVVPLKDESYLTNGYLDTLIDIPGMKDIRLRDLPEHIWGVGQKSTALNFMVKIAKVADEVSHMIFHTFDELESSLIEELKLKFPHVYNIGPLQLLLKEMIERETKNSAFNGYSLWKEETEC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G131270`
TK1151 ID	TkA08G131270
OH-1004 ID	LXL04_031818
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	62.800
Protein coverage (%)	TK1151 100.000 / OH-1004 94.410 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G131270`
Location	Chr08:34080985-34082582 (-)
Description	Similar to UGT85C1: UDP-glycosyltransferase 85C1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_031818` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:1900994 (-)-secologanin biosynthetic process Biological Process GO:0005737 cytoplasm Cellular Component GO:0015020 glucuronosyltransferase activity Molecular Function GO:0035251 UDP-glucosyltransferase activity Molecular Function GO:0080043 quercetin 3-O-glucosyltransferase activity Molecular Function GO:0080044 quercetin 7-O-glucosyltransferase activity Molecular Function GO:0102377 steviol 13-O glucosyltransferase activity Molecular Function GO:0102378 steviolmonoside glucosyltransferase activity Molecular Function
KEGG gene cross-reference	ag:BAK55737 ag:BAK55749 ath:AT1G22380 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.720

Rank 1 · TkA08G131270 · TK1151

Nucleus0.175

Rank 2 · TkA08G131270 · TK1151

Peroxisome0.094

Rank 3 · TkA08G131270 · TK1151

Endoplasmic reticulum0.084

Rank 4 · TkA08G131270 · TK1151

Plastid0.048

Rank 5 · TkA08G131270 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06722EryCIII-like_C79-126 aa

PF25434NUCB1_N191-219 aa

PF00201UDPGT262-422 aa

PF06722EryCIII-like_C346-425 aa

PF04101Glyco_tran_28_C350-424 aa

PF25434NUCB1_N397-446 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G131270	`PF06722`	EryCIII-like_C	79	126	0.00017	22.3
TkA08G131270	`PF25434`	NUCB1_N	191	219	0.26	12.2
TkA08G131270	`PF00201`	UDPGT	262	422	1.9e-22	80.5
TkA08G131270	`PF06722`	EryCIII-like_C	346	425	0.00017	22.3
TkA08G131270	`PF04101`	Glyco_tran_28_C	350	424	2.6e-05	25.1
TkA08G131270	`PF25434`	NUCB1_N	397	446	0.26	12.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card