TkA08G131060 | RubberDandelionOmics

Gene overview

TkA08G131060

Reference: TK1151 Chr: Chr08 Coordinates: 34009416-34020784 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1050 bp · TkA08G131060|TK1151|cDNA

ATGAACCTTACCAAGAATTGGGGTCCTATAATTGACAAGTTTGAAGCGAAGTTATCTGCCTGGGAAGCGGATAGCCTTTCTTTTGGTGGTCGTGTCACATTGGTGCAATCGGTTCTTGGAAGTAAATGGCAAGTGATTGCCAGACTAAAAGACGAGCTTTGTCATTTGGGCATTAATATGGACGAGATGTTGGTGCGAAAAATGGGGAACGGGAGACACACTTTCTTTTGGAAGGACAATTGGCTAGGCGGGGAGTTGCT...

CDS

Download CDS FASTA

1050 bp · TkA08G131060|TK1151|CDS

ATGAACCTTACCAAGAATTGGGGTCCTATAATTGACAAGTTTGAAGCGAAGTTATCTGCCTGGGAAGCGGATAGCCTTTCTTTTGGTGGTCGTGTCACATTGGTGCAATCGGTTCTTGGAAGTAAATGGCAAGTGATTGCCAGACTAAAAGACGAGCTTTGTCATTTGGGCATTAATATGGACGAGATGTTGGTGCGAAAAATGGGGAACGGGAGACACACTTTCTTTTGGAAGGACAATTGGCTAGGCGGGGAGTTGCT...

Protein

Download Protein FASTA

349 aa · TkA08G131060|TK1151|PROTEIN

MNLTKNWGPIIDKFEAKLSAWEADSLSFGGRVTLVQSVLGSKWQVIARLKDELCHLGINMDEMLVRKMGNGRHTFFWKDNWLGGELLKIKYPELYAVERDKNCKVSDRVRCQGADSVAIWDWKRQLRRGRESTAIQQIQAQVSGAVLLDREDAWEWAGCEKGAFSVKRLRSAMQDRLRVSVRSSFQWTAWVPKKVNCLAWRIMLNRLPTKVNLMKRGVNTGSLLCRVCSREQEEVDHLFFTCKFAKEIWEWFIAWSGFYL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G131060`
TK1151 ID	TkA08G131060
OH-1004 ID	LXL04_029180
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	59.000
Protein coverage (%)	TK1151 87.393 / OH-1004 19.732 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G131060`
Location	Chr08:34009416-34020784 (+)
Description	Similar to CMT2: DNA (cytosine-5)-methyltransferase CMT2
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_029180` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006351 DNA-templated transcription Biological Process GO:0032259 methylation Biological Process GO:0034605 cellular response to heat Biological Process GO:0044027 negative regulation of gene expression via chromosomal CpG island methylation Biological Process GO:0141010 transposable element silencing by siRNA-mediated DNA methylation Biological Process GO:0005634 nucleus Cellular Component GO:0003677 DNA binding Molecular Function GO:0003682 chromatin binding Molecular Function GO:0003886 DNA (cytosine-5-)-methyltransferase activity Molecular Function GO:0032183 SUMO binding Molecular Function GO:0051720 DNA (cytosine-5-)-methyltransferase activity, acting on CpNpG substrates Molecular Function
KEGG gene cross-reference	ath:AT4G19020 dosa:Os03g0226800 dosa:Os05g0224800 dosa:Os05g0224900 dosa:Os10g0104900 osa:4338140 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.460

Rank 1 · TkA08G131060 · TK1151

Nucleus0.332

Rank 2 · TkA08G131060 · TK1151

Cell membrane0.194

Rank 3 · TkA08G131060 · TK1151

Golgi apparatus0.053

Rank 4 · TkA08G131060 · TK1151

Endoplasmic reticulum0.046

Rank 5 · TkA08G131060 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF20192DUF6555147-174 aa

PF13966zf-RVT164-249 aa

PF12023DUF3511172-187 aa

PF12023DUF3511323-331 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G131060	`PF20192`	DUF6555	147	174	0.13	13.0
TkA08G131060	`PF13966`	zf-RVT	164	249	2e-19	70.7
TkA08G131060	`PF12023`	DUF3511	172	187	0.053	14.1
TkA08G131060	`PF12023`	DUF3511	323	331	0.053	14.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card