TkA08G127590 | RubberDandelionOmics

Gene overview

TkA08G127590

Reference: TK1151 Chr: Chr08 Coordinates: 33193429-33196038 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2530 bp · TkA08G127590|TK1151|cDNA

TTATGAAAAAATCACACCATCATTTTTTTTTTTGGGTTTGGTTTTAAGATTTTTCCGGGTTTTGGTCAATTTTTGCTCACTCCTGTTTAATGAAGTAAATAATAGGATTAGAAGCATTTCTTTGTATTGGTGTTGTAATTTGAGATCTAAATCCTCTTCATGTCGTATCTGTTTTTGCTATTAGAAACGGAATCATGTGTCCATTTAAGTCTTTCATAGAAATGGAATTATAATCTTAGTTGAAGGACATTAACATTAAA...

CDS

Download CDS FASTA

1803 bp · TkA08G127590|TK1151|CDS

ATGACTTGCGCCAACCCTACTTGTTTCTTCTGCACCATGAAAGAGCCAAACATACTGATCAGGAAATCAGGAATCAAGAAATGCTTCAAAGAAATTCTAACAATCGATGAACAAGAGCGTGTTCTTATTCTAAGCAGTCTATGGAACATCGCCATGACTAAACCTGAAGATCCAGAGTTTCCATCTTTGGGTATATTCAAATGCATGGCAAACTTGGTCAATAAAAGCATTAGCGACCGACCATGGCTTCTTGATGGCCA...

Protein

Download Protein FASTA

600 aa · TkA08G127590|TK1151|PROTEIN

MTCANPTCFFCTMKEPNILIRKSGIKKCFKEILTIDEQERVLILSSLWNIAMTKPEDPEFPSLGIFKCMANLVNKSISDRPWLLDGQNMYIPYYASHIVGSYTMNRFEFAEKAMESGVIPPLMDLMRGKMSWVEQRVAVRALGHLASYDATFEAIAVYEEELVKLTKALASTSSELVYYEFVVKDPNKRVKYHKNLITRGVGGIEMENRKAEEWASQIQCWCLHLLNCFAIRGRSIDVICNQEFLKDLSSMWGGLVNHTS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G127590`
TK1151 ID	TkA08G127590
OH-1004 ID	LXL04_031748
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G127590`
Location	Chr08:33193429-33196038 (+)
Description	Similar to TTC1: Tetratricopeptide repeat protein 1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_031748` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006457 protein folding Biological Process GO:0007338 single fertilization Biological Process GO:0050821 protein stabilization Biological Process GO:0070098 chemokine-mediated signaling pathway Biological Process GO:0070286 axonemal dynein complex assembly Biological Process GO:0005737 cytoplasm Cellular Component GO:0005778 peroxisomal membrane Cellular Component GO:0005829 cytosol Cellular Component GO:0048471 perinuclear region of cytoplasm Cellular Component GO:0120293 dynein axonemal particle Cellular Component GO:0005525 GTP binding Molecular Function GO:0016787 hydrolase activity Molecular Function
KEGG gene cross-reference	bta:504602 dre:266640 hsa:6674 hsa:7265 mmu:66827 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.434

Rank 1 · TkA08G127590 · TK1151

Nucleus0.360

Rank 2 · TkA08G127590 · TK1151

Cell membrane0.112

Rank 3 · TkA08G127590 · TK1151

Plastid0.077

Rank 4 · TkA08G127590 · TK1151

Mitochondrion0.062

Rank 5 · TkA08G127590 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26524ARM_72-241 aa

PF13181TPR_826-38 aa

PF00515TPR_127-37 aa

PF07719TPR_227-37 aa

PF24768ARM_ARMC543-75 aa

PF24768ARM_ARMC5108-177 aa

PF00514Arm115-147 aa

PF10640MCEL_TPase160-210 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G127590	`PF26524`	ARM_7	2	241	4e-122	406.9
TkA08G127590	`PF13181`	TPR_8	26	38	0.27	12.2
TkA08G127590	`PF00515`	TPR_1	27	37	5.1e-05	23.6
TkA08G127590	`PF07719`	TPR_2	27	37	0.0015	19.2
TkA08G127590	`PF24768`	ARM_ARMC5	43	75	0.01	15.9
TkA08G127590	`PF24768`	ARM_ARMC5	108	177	0.01	15.9
TkA08G127590	`PF00514`	Arm	115	147	0.035	14.9
TkA08G127590	`PF10640`	MCEL_TPase	160	210	0.095	12.9
TkA08G127590	`PF30256`	YokC	277	301	0.064	14.0
TkA08G127590	`PF10640`	MCEL_TPase	350	385	0.095	12.9
TkA08G127590	`PF30256`	YokC	352	413	0.064	14.0
TkA08G127590	`PF25575`	TPR_BSK1_C	385	471	2.1e-07	31.5
TkA08G127590	`PF07719`	TPR_2	407	432	0.0015	19.2
TkA08G127590	`PF13424`	TPR_12	407	469	0.021	15.7
TkA08G127590	`PF00515`	TPR_1	412	432	5.1e-05	23.6
TkA08G127590	`PF13181`	TPR_8	414	432	0.27	12.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card