Gene Card
Gene overview
cDNA / CDS / Protein Sequences
3661 bp · TkA08G117330|TK1151|cDNA
ATACAGGCTCGATTAGGCTCGCGAGCCTTATCGAGCTCACCAACATAGGCTCGGGCTCGGCTCGTTTAATAAACGAGCTTTTAAATGGTACTCGAGCTCGGCTCGGGCTCGATTAACTCGAACTCGAATCGAGCTTTTAACGAATCGATCCCGAGTAGCTCACGAGTAGCTCGGCTCGTTTACACCCCTAATCAAGATGAAATAAAATTCTGAAAAAGAAAAAAATCTACTCCACCCACACCCACACCCACACCCACACC...
2523 bp · TkA08G117330|TK1151|CDS
ATGGAGCTTAAGATTCGTTGTAGGAGTAATGGTAATAGTAGTAGATGTGTTGTTTCTTCCAGACGAAAATGTTGGACTGAGCTATTACTTCTACAGATTCTATTAGTCCTGGTATTTTTGGACATCATTCAAGCAAAAAACACCGATGAACAGTTACAATGGAGAGGGCCAGAAAATGTTGCATCGCATTCTTGTATTCATGATGAAATAATCGAGCAAAGAAGAAAGCGACCTGGAAACAAGGTTTATTCTGTAACTCC...
Protein
Download Protein FASTA840 aa · TkA08G117330|TK1151|PROTEIN
MELKIRCRSNGNSSRCVVSSRRKCWTELLLLQILLVLVFLDIIQAKNTDEQLQWRGPENVASHSCIHDEIIEQRRKRPGNKVYSVTPQLYQAHDTSEPLHRKGRALLGIQKVSSFPKNAKQPIRIYLNYDAVGHSPARDCRKVGDIVKLGEPPSASNLGTPTCNPHNDPPIYGDCWYNCTSDDIAGEDKRHRLRRALGQTADWFRRALAVEPVRGNLRLSGYSACGQDGGVQLPREYVEEGVANADLVLLVTTRPTSGNT...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA08G117330 |
|---|---|
| TK1151 ID | TkA08G117330 |
| OH-1004 ID | LXL04_031609 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA08G117330 |
|---|---|
| Location | Chr08:30569608-30575162 (+) |
| Description | Similar to Lmln: Leishmanolysin-like peptidase |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006338 chromatin remodeling Biological Process GO:0006508 proteolysis Biological Process GO:0007052 mitotic spindle organization Biological Process GO:0007076 mitotic chromosome condensation Biological Process GO:0007100 mitotic centrosome separation Biological Process GO:0007155 cell adhesion Biological Process GO:0008354 germ cell migration Biological Process GO:0019915 lipid storage Biological Process GO:0022900 electron transport chain Biological Process GO:0045842 positive regulation of mitotic metaphase/anaphase transition Biological Process GO:0051298 centrosome duplication Biological Process GO:0051301 cell division Biological Process |
| KEGG gene cross-reference | dme:Dmel_CG3953 dpo:4801047 mmu:239833 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF01457Peptidase_M863-148 aaPF01457Peptidase_M8177-601 aaPF06262Zincin_1289-313 aaPF23106EGF_Teneurin443-451 aaPF25024EGF_TEN449-459 aaPF23106EGF_Teneurin505-510 aaPF18720EGF_Tenascin507-511 aaPF25024EGF_TEN530-562 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA08G117330 | PF01457 | Peptidase_M8 | 63 | 148 | 5.1e-89 | 300.1 |
| TkA08G117330 | PF01457 | Peptidase_M8 | 177 | 601 | 5.1e-89 | 300.1 |
| TkA08G117330 | PF06262 | Zincin_1 | 289 | 313 | 0.33 | 11.6 |
| TkA08G117330 | PF23106 | EGF_Teneurin | 443 | 451 | 8.7e-09 | 36.0 |
| TkA08G117330 | PF25024 | EGF_TEN | 449 | 459 | 1e-13 | 52.2 |
| TkA08G117330 | PF23106 | EGF_Teneurin | 505 | 510 | 8.7e-09 | 36.0 |
| TkA08G117330 | PF18720 | EGF_Tenascin | 507 | 511 | 0.018 | 15.8 |
| TkA08G117330 | PF25024 | EGF_TEN | 530 | 562 | 1e-13 | 52.2 |
| TkA08G117330 | PF25024 | EGF_TEN | 610 | 714 | 1e-13 | 52.2 |
| TkA08G117330 | PF23106 | EGF_Teneurin | 611 | 639 | 8.7e-09 | 36.0 |
| TkA08G117330 | PF07974 | EGF_2 | 611 | 637 | 0.00013 | 23.0 |
| TkA08G117330 | PF18720 | EGF_Tenascin | 611 | 638 | 0.018 | 15.8 |
| TkA08G117330 | PF23106 | EGF_Teneurin | 642 | 671 | 8.7e-09 | 36.0 |
| TkA08G117330 | PF07974 | EGF_2 | 642 | 669 | 0.00013 | 23.0 |
| TkA08G117330 | PF18720 | EGF_Tenascin | 642 | 670 | 0.018 | 15.8 |
| TkA08G117330 | PF23106 | EGF_Teneurin | 674 | 702 | 8.7e-09 | 36.0 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.