TkA08G115780 | RubberDandelionOmics

Gene overview

TkA08G115780

Reference: TK1151 Chr: Chr08 Coordinates: 30157337-30159985 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1836 bp · TkA08G115780|TK1151|cDNA

ATGCTTGATTTGGATACCACAAGGACCACCAGGGCAAGAATTCTCAAGGTTGTACTTATATGAAAATTTTAGCCCAATGTCCAGAAGTCAACGGCCGTTGAAGGTCTCTGTATTCGTGTTCACGAGCAAATTTCTTTTTCACGCACAACCAGAACAATGAATCTATTCCTGCTTCTTCTTCTTCTTCTTCTTCCTCTACTCTTCATTTCCTTCAGTATCTTCTTCAAATTCATATGGATCCCACTAAAGATCCAACGCCA...

CDS

Download CDS FASTA

1515 bp · TkA08G115780|TK1151|CDS

ATGAATCTATTCCTGCTTCTTCTTCTTCTTCTTCTTCCTCTACTCTTCATTTCCTTCAGTATCTTCTTCAAATTCATATGGATCCCACTAAAGATCCAACGCCACTTCCGTCAACAAGGCGTTGGAGGTCCCAGCTACCGCCCAATCTTCGGTAACACGGCCGAGATCCGGCGGAGGATGATCGCCGAGGCAGAATCATCACGGTCAGTTTCTTTCAACCATGACGGAGTTGTTCAGAGGGTGATGCCACACTACCACAA...

Protein

Download Protein FASTA

504 aa · TkA08G115780|TK1151|PROTEIN

MNLFLLLLLLLLPLLFISFSIFFKFIWIPLKIQRHFRQQGVGGPSYRPIFGNTAEIRRRMIAEAESSRSVSFNHDGVVQRVMPHYHNWSKTYGDTFLYWFGSTARLALSDPDMIKEILVSKSGSFGKIRFNPVSKALFGEGLVALEGEKWIVHRKITGHAFNMERVKEWVPEIVDSTRNMMSKWDSGRNDTELELDVHKEFHELSADIISRTAFGSNFTQGKRIFELQEQQVALVLKALRSVYIPGFKHLPTKNNRKMWK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G115780`
TK1151 ID	TkA08G115780
OH-1004 ID	LXL04_031601
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.800
Protein coverage (%)	TK1151 97.222 / OH-1004 91.589 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G115780

Location Chr08:30157337-30159985 (+)

Description Similar to CYP734A1: Cytochrome P450 734A1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g26710`	Cytochrome P450 involved in brassinosteroids (BRs) inactivation and regulation of BRs homeostasis.	BAS1 and SOB7 act redundantly to modulate Arabidopsis photomorphogenesis via unique brassinosteroid inactivation mechanisms.2005 · DOI: 10.1111/j.1365-313x.2005.02358.x Arabidopsis CYP72C1 is an atypical cytochrome P450 that inactivates brassinosteroids.2010 · DOI: 10.1007/s11103-010-9663-y
`At2g46950`	Involved in stress response (By similarity).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0388000`	Cytochrome P450 involved in brassinosteroids (BRs) inactivation and regulation of BRs homeostasis.	No verified direct reference in this release
`Os02g0204700`	Cytochrome P450 involved in brassinosteroids (BRs) inactivation and regulation of BRs homeostasis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031601 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009741 response to brassinosteroid Biological Process

GO:0010268 brassinosteroid homeostasis Biological Process

GO:0016131 brassinosteroid metabolic process Biological Process

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0004497 monooxygenase activity Molecular Function

GO:0005506 iron ion binding Molecular Function

GO:0008395 steroid hydroxylase activity Molecular Function

GO:0016705 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen Molecular Function

GO:0020037 heme binding Molecular Function

KEGG gene cross-reference

ath:AT2G26710

ath:AT2G46950

dosa:Os01g0388000

dosa:Os02g0204700

dosa:Os06g0600400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.894

Rank 1 · TkA08G115780 · TK1151

Cytoplasm0.048

Rank 2 · TkA08G115780 · TK1151

Cell membrane0.041

Rank 3 · TkA08G115780 · TK1151

Mitochondrion0.032

Rank 4 · TkA08G115780 · TK1151

Nucleus0.031

Rank 5 · TkA08G115780 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00067p45085-497 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G115780	`PF00067`	p450	85	497	3.6e-79	267.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O48786`	Arabidopsis thaliana	sp\|O48786\|C734A_ARATH Cytochrome P450 734A1	45.600%	Swiss-Prot	Medium
`F4IK45`	Arabidopsis thaliana	sp\|F4IK45\|C70B2_ARATH Cytochrome P450 709B2	40.800%	Swiss-Prot	Medium
`B9X287`	Oryza sativa subsp. japonica	sp\|B9X287\|C7346_ORYSJ Cytochrome P450 734A6	42.100%	Swiss-Prot	Medium
`Q6Z6D6`	Oryza sativa subsp. japonica	sp\|Q6Z6D6\|C7342_ORYSJ Cytochrome P450 734A2	38.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card