TkA08G109660 | RubberDandelionOmics

Gene overview

TkA08G109660

Reference: TK1151 Chr: Chr08 Coordinates: 28500443-28505036 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2665 bp · TkA08G109660|TK1151|cDNA

GGTGTTATCACTTTTACATCCAATTTCTCGACGACGAAACGATGACCATATAAAACCACACTTGTTTATCAAACCAAAATCACACACACACACACACACACACTCAAGAACTTTGTTTCAGAGAGAGAAAGAGAGGGAGAGAGAAAGGGAGAGAGATCTGGACTGACAATCCTATCTTTCATCACAGCACAGACCCTGTTGCTTTACATCATCATCATCACTCATCGGCCATCGCCATCACATATACATACACAATTTTC...

CDS

Download CDS FASTA

1692 bp · TkA08G109660|TK1151|CDS

ATGGAGCATCCTCAACCCCGTCCCTTTGGAGCCCAAGGTAGAAAACCAACGCATGATTTTCTTTCACTTTATTCACCTGCCCAGCAAGATCCATCTCCTACTCCCCCTGGGGGCTACCTTGAAACTCATGACTTCTTACAACCACTAGACCGGGTCGGAAAGACTGCGACTACGAAAGACGGAACGAAAGTCGATGAACCGTCGTCGGTCGGAAAGTCTCTCCCGCCGGCAGCTCCGACTACGGTGGAGCACATACTTCC...

Protein

Download Protein FASTA

563 aa · TkA08G109660|TK1151|PROTEIN

MEHPQPRPFGAQGRKPTHDFLSLYSPAQQDPSPTPPGGYLETHDFLQPLDRVGKTATTKDGTKVDEPSSVGKSLPPAAPTTVEHILPGGIGTYSISHISYINQSQRMPKPEGVVIAAAQSSGSDKNDENSNGSSYTGSGFSLWEESTVKKGKTGKENIAGNRHVVRDEGMKIGGVPWMTSVDRPSQSSSAHNHQSATISSLSSSRPSSTQKNQSFVEMLKSGKSTREDEDDDEEEEFVIKKEPSSHYKGVLSVKVDAAHH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G109660`
TK1151 ID	TkA08G109660
OH-1004 ID	LXL04_031490
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G109660

Location Chr08:28500443-28505036 (-)

Description Similar to BIM1: Transcription factor BIM1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g08130`	Positive brassinosteroid-signaling protein.	A new class of transcription factors mediates brassinosteroid-regulated gene expression in Arabidopsis.2005 · DOI: 10.1016/j.cell.2004.11.044
`At1g69010`	Positive brassinosteroid-signaling protein.	No verified direct reference in this release
`At5g38860`	Positive brassinosteroid-signaling protein.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031490 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0009867 jasmonic acid mediated signaling pathway Biological Process

GO:0010026 trichome differentiation Biological Process

GO:0090628 plant epidermal cell fate specification Biological Process

GO:1902448 positive regulation of shade avoidance Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0042802 identical protein binding Molecular Function

KEGG gene cross-reference

ath:AT1G63650

ath:AT1G69010

ath:AT4G28815

ath:AT5G08130

ath:AT5G38860

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.977

Rank 1 · TkA08G109660 · TK1151

Cytoplasm0.090

Rank 2 · TkA08G109660 · TK1151

Cell membrane0.024

Rank 3 · TkA08G109660 · TK1151

Endoplasmic reticulum0.014

Rank 4 · TkA08G109660 · TK1151

Plastid0.008

Rank 5 · TkA08G109660 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23177bHLH_IRO3210-224 aa

PF00010HLH268-317 aa

PF23183bHLH_NPAS4268-306 aa

PF23177bHLH_IRO3271-327 aa

PF25926DUF7971273-342 aa

PF23173bHLH_SAC51275-318 aa

PF23176bHLH_LHW276-319 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G109660	`PF23177`	bHLH_IRO3	210	224	9.7e-06	26.6
TkA08G109660	`PF00010`	HLH	268	317	7e-16	58.5
TkA08G109660	`PF23183`	bHLH_NPAS4	268	306	0.25	12.1
TkA08G109660	`PF23177`	bHLH_IRO3	271	327	9.7e-06	26.6
TkA08G109660	`PF25926`	DUF7971	273	342	0.13	13.2
TkA08G109660	`PF23173`	bHLH_SAC51	275	318	0.047	14.3
TkA08G109660	`PF23176`	bHLH_LHW	276	319	0.0059	17.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LEZ3`	Arabidopsis thaliana	sp\|Q9LEZ3\|BIM1_ARATH Transcription factor BIM1	42.700%	Swiss-Prot	Medium
`Q9CAA4`	Arabidopsis thaliana	sp\|Q9CAA4\|BIM2_ARATH Transcription factor BIM2	42.800%	Swiss-Prot	Medium
`Q9FMB6`	Arabidopsis thaliana	sp\|Q9FMB6\|BIM3_ARATH Transcription factor BIM3	37.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card