TkA08G106070 | RubberDandelionOmics

Gene overview

TkA08G106070

Reference: TK1151 Chr: Chr08 Coordinates: 27644208-27645945 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

789 bp · TkA08G106070|TK1151|cDNA

ATGGAAGACCACCTGGTTTTGCGTGTTGATCAGCTGGTGACAATCACTGACATAAAGGAAGATAAAGAATACGATACAGCTGGCGAAGAAGAGCCACTCATTCAGTCAATTGAATGTCGTATCTGCCAGGAGGAAGACACCATAAAAAACCTCGAGGTTCCTTGTGCATGTAGTGGCAGCCTCAAGCCTACATTTTTTCTGCAGTTTGCTCATAGGAAATGTGTTCAACGATGGTGTAATGAAAAAGGAGACACAATTTG...

CDS

Download CDS FASTA

789 bp · TkA08G106070|TK1151|CDS

ATGGAAGACCACCTGGTTTTGCGTGTTGATCAGCTGGTGACAATCACTGACATAAAGGAAGATAAAGAATACGATACAGCTGGCGAAGAAGAGCCACTCATTCAGTCAATTGAATGTCGTATCTGCCAGGAGGAAGACACCATAAAAAACCTCGAGGTTCCTTGTGCATGTAGTGGCAGCCTCAAGCCTACATTTTTTCTGCAGTTTGCTCATAGGAAATGTGTTCAACGATGGTGTAATGAAAAAGGAGACACAATTTG...

Protein

Download Protein FASTA

262 aa · TkA08G106070|TK1151|PROTEIN

MEDHLVLRVDQLVTITDIKEDKEYDTAGEEEPLIQSIECRICQEEDTIKNLEVPCACSGSLKPTFFLQFAHRKCVQRWCNEKGDTICEICHQVYEPGYTAPPRQEDTVLDIRHHLNDPRLLAMAAAERSLLDAEYEYEDTGANGASFCRSAALILMALLLLRHALTIGDGDDDDDDASAFFALFMLRAAGFLLPCYIMAWAINILQRRRQAQVLSFICSADVAFMMQAGQHRGLQVTIAPGPAVAPTVIPAPVVGPTHGT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G106070`
TK1151 ID	TkA08G106070
OH-1004 ID	LXL04_031429
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	72.500
Protein coverage (%)	TK1151 100.000 / OH-1004 85.429 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G106070`
Location	Chr08:27644208-27645945 (-)
Description	Similar to SUD1: Probable E3 ubiquitin ligase SUD1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_031429` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006897 endocytosis Biological Process GO:0008299 isoprenoid biosynthetic process Biological Process GO:0009414 response to water deprivation Biological Process GO:0010025 wax biosynthetic process Biological Process GO:0010143 cutin biosynthetic process Biological Process GO:0010345 suberin biosynthetic process Biological Process GO:0016567 protein ubiquitination Biological Process GO:0036503 ERAD pathway Biological Process GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process GO:1900486 positive regulation of isopentenyl diphosphate biosynthetic process, mevalonate pathway Biological Process GO:0005764 lysosome Cellular Component GO:0005768 endosome Cellular Component
KEGG gene cross-reference	ath:AT4G34100 hsa:115123 mmu:320253 xla:779329 xtr:493225 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.381

Rank 1 · TkA08G106070 · TK1151

Cell membrane0.259

Rank 2 · TkA08G106070 · TK1151

Endoplasmic reticulum0.229

Rank 3 · TkA08G106070 · TK1151

Cytoplasm0.182

Rank 4 · TkA08G106070 · TK1151

Golgi apparatus0.146

Rank 5 · TkA08G106070 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF31167SCO1756_N33-75 aa

PF12906RINGv39-90 aa

PF23733GRXCR1-2_C53-90 aa

PF12428DUF367596-202 aa

PF12806Acyl-CoA_dh_C130-181 aa

PF25970SEC22a_C152-218 aa

PF12806Acyl-CoA_dh_C174-211 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G106070	`PF31167`	SCO1756_N	33	75	0.42	11.4
TkA08G106070	`PF12906`	RINGv	39	90	1e-11	45.5
TkA08G106070	`PF23733`	GRXCR1-2_C	53	90	0.68	10.6
TkA08G106070	`PF12428`	DUF3675	96	202	3.6e-33	115.4
TkA08G106070	`PF12806`	Acyl-CoA_dh_C	130	181	0.25	12.2
TkA08G106070	`PF25970`	SEC22a_C	152	218	0.045	14.8
TkA08G106070	`PF12806`	Acyl-CoA_dh_C	174	211	0.25	12.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card