RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA08G105820
Reference: TK1151 Chr: Chr08 Coordinates: 27569643-27577457 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1160 bp · TkA08G105820|TK1151|cDNA

TTGGGGAGCGCCCGTAGAGCCTCGAAGTAGGTGATTACAAACTCCCCAAAACCCTAACTGACCCGTTTTCCCTTTTTCCTTAAACTCCCCAAAACCCTAAACGACAACAAGTTCCTACGAAGCTCCTTCCTCAAACCAAACCACTTCTCTCAGTCGAGAGTAAAGCCGATTCTCTGTTTCCATCAACAATGGTGGCTGACAAGGGTAAGAAACCCAAGGTAGCAGAGAAAATCGTAGAAGAAAACGCCGAGCAAATCGAC...

CDS

Download CDS FASTA

783 bp · TkA08G105820|TK1151|CDS

ATGGTGGCTGACAAGGGTAAGAAACCCAAGGTAGCAGAGAAAATCGTAGAAGAAAACGCCGAGCAAATCGACGGCGAGCTTGTTCTGTCCATCGAAAAGTTGCAGGAGGTCCAAGACGAACTTGAAAAGATCAACGAGGAGGCAAGTGATAAAGTATTGGAAGTCGAACAGAAATACAATGAGGTTCGGAAGCCAGTATATGATAAACGAAGTGAAATCATCAAATCAATTCCTGATTTCTGGCTAACTGCTTTCTTGAG...

Protein

Download Protein FASTA

260 aa · TkA08G105820|TK1151|PROTEIN

MVADKGKKPKVAEKIVEENAEQIDGELVLSIEKLQEVQDELEKINEEASDKVLEVEQKYNEVRKPVYDKRSEIIKSIPDFWLTAFLSHPVLSDLLSEEDQKIFKHLTSLEVEDCKDVKLGYSISFNFSPNPYFEDSKLTKTFTFLDEGTTKITATSIKWKEGMGIPNGVAHEKKGNKRAHEDDSFFSWFNGTQQKDDMEDIHDEVAEIIREDLWTNPLTYFNNDADEEELEGDEEENGSDESEEDGEEEEEEEEGDDEGN

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA08G105820
TK1151 IDTkA08G105820
OH-1004 IDLXL04_031421
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)100.000
Protein coverage (%)TK1151 89.231 / OH-1004 88.550
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA08G105820
LocationChr08:27569643-27577457 (-)
DescriptionSimilar to NRP2: NAP1-related protein 2
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g74560 Acts as a histone H2A/H2B chaperone in nucleosome assembly, playing a critical role for the correct expression of genes involved in root proliferation and patterning. No verified direct reference in this release
At1g18800 Acts as a histone H2A/H2B chaperone in nucleosome assembly, playing a critical role for the correct expression of genes involved in root proliferation and patterning.
Arabidopsis NRP1 and NRP2 encode histone chaperones and are required for maintaining postembryonic root growth.2006 · DOI: 10.1105/tpc.106.046490
Chromatin remodeling in Arabidopsis root growth.2007 · DOI: 10.4161/psb.2.3.3687
NAP1 family histone chaperones are required for somatic homologous recombination in Arabidopsis.2012 · DOI: 10.1105/tpc.112.096792

Rice

Reference gene IDPossible functionPapers / DOI
Os02g0576700 Acts as a histone H2A/H2B chaperone in nucleosome assembly. No verified direct reference in this release
UniProt: B8AEC1 Acts as a histone H2A/H2B chaperone in nucleosome assembly. No verified direct reference in this release
UniProt: A2XU85 Acts as a histone H2A/H2B chaperone in nucleosome assembly. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_031421 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0000724 double-strand break repair via homologous recombination Biological Process
GO:0006334 nucleosome assembly Biological Process
GO:0016444 somatic cell DNA recombination Biological Process
GO:0000785 chromatin Cellular Component
GO:0005634 nucleus Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0005829 cytosol Cellular Component
GO:0003682 chromatin binding Molecular Function
GO:0042393 histone binding Molecular Function
KEGG gene cross-reference
ath:AT1G18800
ath:AT1G74560
dosa:Os02g0576700
dosa:Os04g0459700
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.615
Rank 1 · TkA08G105820 · TK1151
Cytoplasm0.613
Rank 2 · TkA08G105820 · TK1151
Mitochondrion0.049
Rank 3 · TkA08G105820 · TK1151
Cell membrane0.041
Rank 4 · TkA08G105820 · TK1151
Endoplasmic reticulum0.040
Rank 5 · TkA08G105820 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07889DUF166421-66 aa
PF00956NAP31-75 aa
PF07516SecA_SW33-76 aa
PF15679DUF466533-67 aa
PF00956NAP75-221 aa
PF03937Sdh591-108 aa
PF28861Ig_BT4661_6th131-171 aa
PF03937Sdh5180-207 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA08G105820PF07889DUF166421668.17.2
TkA08G105820PF00956NAP31751.4e-32113.7
TkA08G105820PF07516SecA_SW33760.006717.2
TkA08G105820PF15679DUF466533670.1413.5
TkA08G105820PF00956NAP752211.4e-32113.7
TkA08G105820PF03937Sdh5911080.1812.5
TkA08G105820PF28861Ig_BT4661_6th1311710.1912.6
TkA08G105820PF03937Sdh51802070.1812.5
TkA08G105820PF06524NOA361902560.2811.2
TkA08G105820PF07889DUF16641962078.17.2
TkA08G105820PF28861Ig_BT4661_6th1982270.1912.6
TkA08G105820PF07516SecA_SW2012090.006717.2
TkA08G105820PF00956NAP2262521.4e-32113.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9CA59Arabidopsis thalianasp|Q9CA59|NRP1_ARATH NAP1-related protein 175.200%Swiss-ProtHigh
Q8LC68Arabidopsis thalianasp|Q8LC68|NRP2_ARATH NAP1-related protein 274.200%Swiss-ProtHigh
Q69JW2Oryza sativa subsp. japonicasp|Q69JW2|NRP2_ORYSJ NAP1-related protein 267.700%Swiss-ProtHigh
B8AEC1Oryza sativa subsp. indicasp|B8AEC1|NRP2_ORYSI NAP1-related protein 267.700%Swiss-ProtHigh
A2XU85Oryza sativa subsp. indicasp|A2XU85|NRP1_ORYSI NAP1-related protein 162.000%Swiss-ProtHigh

JBrowse

View in Genome Browser