TkA08G105560 | RubberDandelionOmics

Gene overview

TkA08G105560

Reference: TK1151 Chr: Chr08 Coordinates: 27382859-27389275 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4626 bp · TkA08G105560|TK1151|cDNA

ATGGAGTGGCCCACTGGCATTTCCCACAAGGAAATACCTTTCTTTCTCTACGTCCGCTTTTCTTCCTTCTTTCATCATGCCTTTTTTACAAATTTAAGCTACCAAGTAACCTACCCATCAGTAGTTTTGTCGGGTATTTCTTCCATTTTATCAACTACCGATCAAGATTGACTTGCAATAGACCAATAGTGGTAATTGGGAGGATTTTTCACCGCTTGTACCGTTTTACAGTTTTAAAACGTTTAAAGACGAGATTTTTG...

CDS

Download CDS FASTA

3912 bp · TkA08G105560|TK1151|CDS

ATGGCAAAGAGTGAAGGTGAGAGACTGTCAATGCAAGGAAAAAGTATAGTGGAGAATAACCTTGTGGAAATCAATAACATCAAAGGAGATTTAGAACTTGACAAAACTTCTGAAGGCATTGAAACAGAGTCATGGTATCCTTCTATCAATGATTCTGATATTTGGCTTCCCCCTGAACCAGATGATGTTGAGGGTAGTTTTGGTAATTTTGAGGAAAATAATTATGATGATGATGATGATGATGATGATGATGATGATGA...

Protein

Download Protein FASTA

1303 aa · TkA08G105560|TK1151|PROTEIN

MAKSEGERLSMQGKSIVENNLVEINNIKGDLELDKTSEGIETESWYPSINDSDIWLPPEPDDVEGSFGNFEENNYDDDDDDDDDDDDDDNEWGKSSNLSHDGSRKFRFREEKRKAMDEVINGKFKTLVKSIIKSMGISRLKDNDGNTWVDTVTSLSWKAASFLKEEAMDPYSYVKVKCIATGSRSQSEVFNGLVFKKKAAHKHMPTRIKRPKLLLIKGALSGSEGFSSFDSMNHEKNRLDSVIGMIEKCNPNVILVEKTV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G105560`
TK1151 ID	TkA08G105560
OH-1004 ID	LXL04_031416
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	95.000
Protein coverage (%)	TK1151 98.926 / OH-1004 65.319 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G105560

Location Chr08:27382859-27389275 (-)

Description Similar to FAB1D: Putative 1-phosphatidylinositol-3-phosphate 5-kinase FAB1D

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g34260`	The PI(3,5)P2 regulatory complex regulates both the synthesis and turnover of phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2).	No verified direct reference in this release
`At4g33240`	The PI(3,5)P2 regulatory complex regulates both the synthesis and turnover of phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2).	Arabidopsis FAB1/PIKfyve proteins are essential for development of viable pollen.2009 · DOI: 10.1104/pp.109.146159 Loss-of-function and gain-of-function mutations in FAB1A/B impair endomembrane homeostasis, conferring pleiotropic developmental abnormalities in Arabidopsis.2011 · DOI: 10.1104/pp.110.167981 Arabidopsis FAB1A/B is possibly involved in the recycling of auxin transporters.2011 · DOI: 10.4161/psb.6.4.15023
`At3g14270`	The PI(3,5)P2 regulatory complex regulates both the synthesis and turnover of phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2).	Arabidopsis FAB1/PIKfyve proteins are essential for development of viable pollen.2009 · DOI: 10.1104/pp.109.146159 Loss-of-function and gain-of-function mutations in FAB1A/B impair endomembrane homeostasis, conferring pleiotropic developmental abnormalities in Arabidopsis.2011 · DOI: 10.1104/pp.110.167981
`At1g71010`	The PI(3,5)P2 regulatory complex regulates both the synthesis and turnover of phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031416 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007033 vacuole organization Biological Process

GO:0046854 phosphatidylinositol phosphate biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0010008 endosome membrane Cellular Component

GO:0000285 1-phosphatidylinositol-3-phosphate 5-kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G34260

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.397

Rank 1 · TkA08G105560 · TK1151

Cytoplasm0.393

Rank 2 · TkA08G105560 · TK1151

Cell membrane0.213

Rank 3 · TkA08G105560 · TK1151

Endoplasmic reticulum0.075

Rank 4 · TkA08G105560 · TK1151

Lysosome / Vacuole0.053

Rank 5 · TkA08G105560 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00118Cpn60_TCP1145-378 aa

PF01504PIP5K505-528 aa

PF01504PIP5K1051-1213 aa

PF01504PIP5K1213-1265 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G105560	`PF00118`	Cpn60_TCP1	145	378	2.7e-23	83.2
TkA08G105560	`PF01504`	PIP5K	505	528	6.1e-42	144.5
TkA08G105560	`PF01504`	PIP5K	1051	1213	6.1e-42	144.5
TkA08G105560	`PF01504`	PIP5K	1213	1265	6.1e-42	144.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XID0`	Arabidopsis thaliana	sp\|Q9XID0\|FAB1D_ARATH Putative 1-phosphatidylinositol-3-phosphate 5-kinase FAB1D	42.500%	Swiss-Prot	Medium
`Q0WUR5`	Arabidopsis thaliana	sp\|Q0WUR5\|FAB1A_ARATH 1-phosphatidylinositol-3-phosphate 5-kinase FAB1A	34.100%	Swiss-Prot	Medium
`Q9LUM0`	Arabidopsis thaliana	sp\|Q9LUM0\|FAB1B_ARATH 1-phosphatidylinositol-3-phosphate 5-kinase FAB1B	33.400%	Swiss-Prot	Medium
`Q9SSJ8`	Arabidopsis thaliana	sp\|Q9SSJ8\|FAB1C_ARATH Putative 1-phosphatidylinositol-3-phosphate 5-kinase FAB1C	32.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card