TkA08G104360 | RubberDandelionOmics

Gene overview

TkA08G104360

Reference: TK1151 Chr: Chr08 Coordinates: 27090155-27091362 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

684 bp · TkA08G104360|TK1151|cDNA

ATGATGGAAGGGAGCTTAGGGGAGAGATCGGGGATTAACGAATCTGTGATCATAAAAGCTTCTTCTTTAGCGGTTAAATCACACAAATCCAGTGGATACTATACAAAGGAATCCGGTCCAGATGAAACCATTTTTGCCTTCACTGGATCATGGTCCGTTGATGATTTTTACAACCGGGACCCGTTTGGTGAGACCAAGATCGATCTTTTGTTATTTCCGTCACTAAAAAGCATTGGAAACAATGAACTTGCCATGATCAA...

CDS

Download CDS FASTA

684 bp · TkA08G104360|TK1151|CDS

ATGATGGAAGGGAGCTTAGGGGAGAGATCGGGGATTAACGAATCTGTGATCATAAAAGCTTCTTCTTTAGCGGTTAAATCACACAAATCCAGTGGATACTATACAAAGGAATCCGGTCCAGATGAAACCATTTTTGCCTTCACTGGATCATGGTCCGTTGATGATTTTTACAACCGGGACCCGTTTGGTGAGACCAAGATCGATCTTTTGTTATTTCCGTCACTAAAAAGCATTGGAAACAATGAACTTGCCATGATCAA...

Protein

Download Protein FASTA

227 aa · TkA08G104360|TK1151|PROTEIN

MMEGSLGERSGINESVIIKASSLAVKSHKSSGYYTKESGPDETIFAFTGSWSVDDFYNRDPFGETKIDLLLFPSLKSIGNNELAMINQGFFRRFQSLLQTPSFKTDVEKAVKKEKPVIFTGHSSGGPVAILAAVWYLEEHTRSKGRTPCKCLTFGSPLVGDRIFTHAINRENWSRFFLHFIGRYDIVPRITLAPFSSLKNEFPHILDFFNPKSRSFRNPRFPGPKKL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G104360`
TK1151 ID	TkA08G104360
OH-1004 ID	LXL04_030686
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	45.200
Protein coverage (%)	TK1151 83.700 / OH-1004 31.723 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G104360

Location Chr08:27090155-27091362 (-)

Description Similar to EDS1: Protein EDS1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q9XF23`	Positive regulator of basal resistance and of effector-triggered immunity specifically mediated by TIR-NB-LRR resistance proteins.	No verified direct reference in this release
`At3g48090`	Positive regulator of basal resistance and of effector-triggered immunity specifically mediated by TIR-NB-LRR (TNL) resistance proteins.	EDS1, an essential component of R gene-mediated disease resistance in Arabidopsis has homology to eukaryotic lipases.1999 · DOI: 10.1073/pnas.96.6.3292 Direct interaction between the Arabidopsis disease resistance signaling proteins, EDS1 and PAD4.2001 · DOI: 10.1093/emboj/20.19.5400 Arabidopsis SENESCENCE-ASSOCIATED GENE101 stabilizes and signals within an ENHANCED DISEASE SUSCEPTIBILITY1 complex in plant innate immunity.2005 · DOI: 10.1105/tpc.105.033910 Balanced nuclear and cytoplasmic activities of EDS1 are required for a complete plant innate immune response.2010 · DOI: 10.1371/journal.ppat.1000970 Different roles of Enhanced Disease Susceptibility1 (EDS1) bound to and dissociated from Phytoalexin Deficient4 (PAD4) in Arabidopsis immunity.2011 · DOI: 10.1111/j.1469-8137.2011.03675.x Pathogen effectors target Arabidopsis EDS1 and alter its interactions with immune regulators.2011 · DOI: 10.1126/science.1211592 EDS1 contributes to nonhost resistance of Arabidopsis thaliana against Erwinia amylovora.2012 · DOI: 10.1094/mpmi-05-11-0111 Contrasting Roles of the Apoplastic Aspartyl Protease APOPLASTIC, ENHANCED DISEASE SUSCEPTIBILITY1-DEPENDENT1 and LEGUME LECTIN-LIKE PROTEIN1 in Arabidopsis Systemic Acquired Resistance.2014 · DOI: 10.1104/pp.114.239665
`At3g48080`	Acts as a second functional copy of EDS1.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030686 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000304 response to singlet oxygen Biological Process

GO:0001666 response to hypoxia Biological Process

GO:0002213 defense response to insect Biological Process

GO:0006629 lipid metabolic process Biological Process

GO:0006952 defense response Biological Process

GO:0009617 response to bacterium Biological Process

GO:0009625 response to insect Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0009627 systemic acquired resistance Biological Process

GO:0009751 response to salicylic acid Biological Process

GO:0009862 systemic acquired resistance, salicylic acid mediated signaling pathway Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

KEGG gene cross-reference

ath:AT3G48080

ath:AT3G48090

ath:AT3G52430

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.473

Rank 1 · TkA08G104360 · TK1151

Plastid0.384

Rank 2 · TkA08G104360 · TK1151

Nucleus0.191

Rank 3 · TkA08G104360 · TK1151

Peroxisome0.084

Rank 4 · TkA08G104360 · TK1151

Mitochondrion0.078

Rank 5 · TkA08G104360 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26363Phospholipase-like34-58 aa

PF28687STR4A_N52-62 aa

PF01764Lipase_383-192 aa

PF12697Abhydrolase_6108-182 aa

PF12146Hydrolase_4109-134 aa

PF05057DUF676109-166 aa

PF26363Phospholipase-like112-136 aa

PF11187Mbeg1-like112-135 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G104360	`PF26363`	Phospholipase-like	34	58	0.17	11.8
TkA08G104360	`PF28687`	STR4A_N	52	62	0.16	12.3
TkA08G104360	`PF01764`	Lipase_3	83	192	2.1e-19	70.5
TkA08G104360	`PF12697`	Abhydrolase_6	108	182	0.048	15.0
TkA08G104360	`PF12146`	Hydrolase_4	109	134	0.27	11.2
TkA08G104360	`PF05057`	DUF676	109	166	0.31	11.2
TkA08G104360	`PF26363`	Phospholipase-like	112	136	0.17	11.8
TkA08G104360	`PF11187`	Mbeg1-like	112	135	0.23	11.5
TkA08G104360	`PF28687`	STR4A_N	207	210	0.16	12.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XF23`	Arabidopsis thaliana	sp\|Q9XF23\|EDS1L_ARATH Protein EDS1L	42.200%	Swiss-Prot	Medium
`Q9SU72`	Arabidopsis thaliana	sp\|Q9SU72\|EDS1C_ARATH Protein EDS1	41.700%	Swiss-Prot	Medium
`Q9SU71`	Arabidopsis thaliana	sp\|Q9SU71\|EDSBC_ARATH Protein EDS1B	42.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card