TkA08G104350 | RubberDandelionOmics

Gene overview

TkA08G104350

Reference: TK1151 Chr: Chr08 Coordinates: 27087344-27089671 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2146 bp · TkA08G104350|TK1151|cDNA

GAACCAAGCGTTTTCGTGCTCAATTACACCGAGCGAGAAGGGCAAAACTGTAATTTCGGCAGTTGTATTTAGCTCTAGATGTTTGAAAGAGGGGCGAAGAAGCAGCAGTTTCCCTTATTTATCCACGCAATTTACTTTTTCACAAATATCTTCCTTTCTGAGATATTTCGCATACGATTTTGGGTATTTTTAGGTTTTCTTCCAGAGAATTCTCAGCCATGGGTTACGATTCGATTCCGATTGCGGCATCAAACGCCAAG...

CDS

Download CDS FASTA

747 bp · TkA08G104350|TK1151|CDS

ATGGGTTACGATTCGATTCCGATTGCGGCATCAAACGCCAAGGAATTTGCCAAGAAAAAAGGGGTGAATAGAACAGCCAAATTGAAGCAGAGTAAGCTTGATGTTCGTCGCGAACAGTGGCTTTCCCATGTGAAGAACAAAGGATGCAAGAAAGAAACTTCCGATGTGAAAATGCCTGCTCCGTACGTACATGAACGGAACGATGACTCGCCAGTGGTGAAATTGGAGATTAATCCTGGTGGTGAAGAGGATGAGGGTTT...

Protein

Download Protein FASTA

248 aa · TkA08G104350|TK1151|PROTEIN

MGYDSIPIAASNAKEFAKKKGVNRTAKLKQSKLDVRREQWLSHVKNKGCKKETSDVKMPAPYVHERNDDSPVVKLEINPGGEEDEGLTNHCSDSDSPINSPMSSNVFGSNSSPSHFTCSSSSSSCSESMAEEDDGDNDCLDDWETIADALAADEIKNNNPDPNPEPDSVTVTLESQSDCCPRAWRPDDAFRPQSLPNLLKQNSFPCFKNVSSPSTCPICCEDLDMTDTSFLPCPCGYRLCLFSATRES

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G104350`
TK1151 ID	TkA08G104350
OH-1004 ID	LXL04_031387
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.400
Protein coverage (%)	TK1151 99.194 / OH-1004 87.943 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G104350`
Location	Chr08:27087344-27089671 (+)
Description	Similar to MOT2: General negative regulator of transcription subunit 4 (Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_031387` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000209 protein polyubiquitination Biological Process GO:0000289 nuclear-transcribed mRNA poly(A) tail shortening Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006511 ubiquitin-dependent protein catabolic process Biological Process GO:0006513 protein monoubiquitination Biological Process GO:0010498 proteasomal protein catabolic process Biological Process GO:0016567 protein ubiquitination Biological Process GO:0031047 regulatory ncRNA-mediated gene silencing Biological Process GO:0031087 deadenylation-independent decapping of nuclear-transcribed mRNA Biological Process GO:0032968 positive regulation of transcription elongation by RNA polymerase II Biological Process GO:0051865 protein autoubiquitination Biological Process GO:0070966 nuclear-transcribed mRNA catabolic process, no-go decay Biological Process
KEGG gene cross-reference	hsa:4850 mmu:53621 sce:YER068W spo:2542325 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.881

Rank 1 · TkA08G104350 · TK1151

Cytoplasm0.197

Rank 2 · TkA08G104350 · TK1151

Cell membrane0.060

Rank 3 · TkA08G104350 · TK1151

Endoplasmic reticulum0.041

Rank 4 · TkA08G104350 · TK1151

Plastid0.014

Rank 5 · TkA08G104350 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25511Ig_CNNM4_N39-80 aa

PF26200Rcat_RNF21641-56 aa

PF14570zf-RING_4125-134 aa

PF25511Ig_CNNM4_N126-126 aa

PF26200Rcat_RNF216215-241 aa

PF14570zf-RING_4216-242 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G104350	`PF25511`	Ig_CNNM4_N	39	80	0.083	13.7
TkA08G104350	`PF26200`	Rcat_RNF216	41	56	0.15	13.3
TkA08G104350	`PF14570`	zf-RING_4	125	134	1.5e-08	35.0
TkA08G104350	`PF25511`	Ig_CNNM4_N	126	126	0.083	13.7
TkA08G104350	`PF26200`	Rcat_RNF216	215	241	0.15	13.3
TkA08G104350	`PF14570`	zf-RING_4	216	242	1.5e-08	35.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card