TkA08G102900 | RubberDandelionOmics

Gene overview

TkA08G102900

Reference: TK1151 Chr: Chr08 Coordinates: 26673254-26676011 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2253 bp · TkA08G102900|TK1151|cDNA

GCCAATTCGACCAAATTGATAACATACATTTCATCACCAGTCCACCGGTAAGGTCGTTGAGACCTCCGCCCTCTTTCGATACACTCGAGGAACCATTTCTCACATAAAAACCTCTCCTGCATTTGTTGATCCACCTCTCCATCGAAACAATCAACGATGGCGCAACTCCTCAATTCCTCCTTCACTCCCACCTCTCGCGCCCTCCGCCGTCAATCTGTACCTCTAATCACTCAACCCACCTCCCGAAATCCCAAATTCAA...

CDS

Download CDS FASTA

879 bp · TkA08G102900|TK1151|CDS

ATGGAGGAAAGAAATTGTCGCGTCTCCCTACGCAAAAAAGCTCGCGAAGGAATTGAATGTCGATTTGAGCGGCGTCATTGGTACCGGACCGATGGCAGGATTGTGGCCAAAGATGTAGAGGCTGCCGTTGTTGCTTCCGTCACTGTTCCCGTCGCCGCCGCGACTGATTCAACTAAGCTGATTTCCACCGCTCCAGGGATCGAATTGGGTTCTGTAGTTCCGTTTACGACAATGCAAGGCGCTGTTAGTCGGAACATGGT...

Protein

Download Protein FASTA

292 aa · TkA08G102900|TK1151|PROTEIN

MEERNCRVSLRKKAREGIECRFERRHWYRTDGRIVAKDVEAAVVASVTVPVAAATDSTKLISTAPGIELGSVVPFTTMQGAVSRNMVESLGVPTFRVGYTITTDALDALYKKIKPKGWVTMTALLAKATALALAKHPVVNSSCRDGKSFTYNSNINIAVAVAIDGGLITPVLQNADKVDIYSLSRKWKELVDKARAKQLQPQEYSTGTFTLSNLGMFGVDRFDAILPPGTGAIMAVGASEPTVVATKDGRIGMKNQMQVN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G102900`
TK1151 ID	TkA08G102900
OH-1004 ID	LXL04_031358
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.200
Protein coverage (%)	TK1151 89.384 / OH-1004 56.034 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G102900

Location Chr08:26673254-26676011 (+)

Description Similar to EMB3003: Dihydrolipoyllysine-residue acetyltransferase component 5 of pyruvate dehydrogenase complex, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g34430`	The pyruvate dehydrogenase complex catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2).	No verified direct reference in this release
`At3g25860`	The pyruvate dehydrogenase complex catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031358 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006086 pyruvate decarboxylation to acetyl-CoA Biological Process

GO:0006096 glycolytic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009534 chloroplast thylakoid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0022626 cytosolic ribosome Cellular Component

GO:0045254 pyruvate dehydrogenase complex Cellular Component

GO:0004742 dihydrolipoyllysine-residue acetyltransferase activity Molecular Function

GO:0019904 protein domain specific binding Molecular Function

KEGG gene cross-reference

ath:AT1G34430

ath:AT3G25860

rbe:RBE_0300

rco:RC0764

rfe:RF_0761

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.390

Rank 1 · TkA08G102900 · TK1151

Peroxisome0.280

Rank 2 · TkA08G102900 · TK1151

Cytoplasm0.241

Rank 3 · TkA08G102900 · TK1151

Plastid0.136

Rank 4 · TkA08G102900 · TK1151

Nucleus0.091

Rank 5 · TkA08G102900 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05862IceA222-48 aa

PF05862IceA270-84 aa

PF001982-oxoacid_dh72-290 aa

PF16509KORA84-130 aa

PF00155Aminotran_1_289-137 aa

PF05862IceA2150-171 aa

PF05258DciA176-211 aa

PF16509KORA218-229 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G102900	`PF05862`	IceA2	22	48	0.013	16.1
TkA08G102900	`PF05862`	IceA2	70	84	0.013	16.1
TkA08G102900	`PF00198`	2-oxoacid_dh	72	290	1.6e-65	221.6
TkA08G102900	`PF16509`	KORA	84	130	0.035	15.0
TkA08G102900	`PF00155`	Aminotran_1_2	89	137	0.088	12.7
TkA08G102900	`PF05862`	IceA2	150	171	0.013	16.1
TkA08G102900	`PF05258`	DciA	176	211	0.19	12.7
TkA08G102900	`PF16509`	KORA	218	229	0.035	15.0
TkA08G102900	`PF00155`	Aminotran_1_2	256	265	0.088	12.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C8P0`	Arabidopsis thaliana	sp\|Q9C8P0\|ODP25_ARATH Dihydrolipoyllysine-residue acetyltransferase component 5 of pyruvate dehydrogenase complex, chloroplastic	89.300%	Swiss-Prot	High
`Q9SQI8`	Arabidopsis thaliana	sp\|Q9SQI8\|ODP24_ARATH Dihydrolipoyllysine-residue acetyltransferase component 4 of pyruvate dehydrogenase complex, chloroplastic	78.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card