TkA08G100730 | RubberDandelionOmics

Gene overview

TkA08G100730

Reference: TK1151 Chr: Chr08 Coordinates: 26117980-26123298 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1838 bp · TkA08G100730|TK1151|cDNA

ATCATTTTCTCATAAAACAATAATAAGCAAGCAAATCAGGTATTTGTTCCGGATCACGTAAAGCATGGTTTTTGTTTAAACAAACACGTGCCTCTCAATCTTCTAGACCTGTCAACACTCTGGTGTCTTCAACAAAATTTCCCATTAAATTCCCTTCTCTTCCTCACTTCACCTTCACAATCTTCTCCCCTTTTTCTGATTCACAAATCACAATGGCAATATGGCTGGCCGGTAGAAGAGGTGCCAATTATTTCAACAAA...

CDS

Download CDS FASTA

1452 bp · TkA08G100730|TK1151|CDS

ATGGCAATATGGCTGGCCGGTAGAAGAGGTGCCAATTATTTCAACAAAACATTGATATCTACCACTTTCATCAGATCATTACAGACTTCCCCCACCGTTACTGCTTCCGATGACTGCATCGGAATTTGCAGAAAGCCATATTCTATGTTTCCATGCGGTAACTCATCACCGCCGGCCTATTTCAGATCTCGACGCTTTGAATCGTCGAAAGCTCAGCAGCGATTGGATTTCAGCTCTAGCGATGAAGACGAGGAACAAAT...

Protein

Download Protein FASTA

483 aa · TkA08G100730|TK1151|PROTEIN

MAIWLAGRRGANYFNKTLISTTFIRSLQTSPTVTASDDCIGICRKPYSMFPCGNSSPPAYFRSRRFESSKAQQRLDFSSSDEDEEQIQGMEFPGGKIGFTSEMSFVPESSQKRVQCYRVLDDNGYQLSSTSSLQHVNKEVAMKMYSGMVTLETMDTVLYEAQRQGRITFYLTSFGEEAINLASAAALTSDDLIMPQYREPGVLWWRGFTLQEFVNQCFGNKNDYGKGRQMPIHYGSNKLNYFTVSSPLATQLPQAVGAAY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G100730`
TK1151 ID	TkA08G100730
OH-1004 ID	LXL04_031300
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G100730

Location Chr08:26117980-26123298 (+)

Description Similar to At5g09300: 2-oxoisovalerate dehydrogenase subunit alpha 2, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g09300`	The branched-chain alpha-keto dehydrogenase complex catalyzes the overall conversion of alpha-keto acids to acyl-CoA and CO(2).	No verified direct reference in this release
`At1g21400`	The branched-chain alpha-keto dehydrogenase complex catalyzes the overall conversion of alpha-keto acids to acyl-CoA and CO(2).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031300 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009083 branched-chain amino acid catabolic process Biological Process

GO:0009646 response to absence of light Biological Process

GO:0009744 response to sucrose Biological Process

GO:0043617 cellular response to sucrose starvation Biological Process

GO:0120552 branched-chain alpha-keto acid decarboxylation to branched-chain acyl-CoA Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0160157 branched-chain alpha-ketoacid dehydrogenase complex Cellular Component

GO:0003863 branched-chain 2-oxo acid dehydrogenase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G21400

ath:AT5G09300

ddi:DDB_G0286335

mcf:102134149

ptr:468889

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.932

Rank 1 · TkA08G100730 · TK1151

Cytoplasm0.044

Rank 2 · TkA08G100730 · TK1151

Nucleus0.041

Rank 3 · TkA08G100730 · TK1151

Plastid0.034

Rank 4 · TkA08G100730 · TK1151

Cell membrane0.016

Rank 5 · TkA08G100730 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF15305IFT4383-151 aa

PF00676E1_dh148-442 aa

PF02775TPP_enzyme_C242-310 aa

PF13292DXP_synthase_N249-313 aa

PF13292DXP_synthase_N416-435 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G100730	`PF15305`	IFT43	83	151	0.15	13.0
TkA08G100730	`PF00676`	E1_dh	148	442	9.5e-97	324.3
TkA08G100730	`PF02775`	TPP_enzyme_C	242	310	0.00022	21.8
TkA08G100730	`PF13292`	DXP_synthase_N	249	313	0.00025	21.2
TkA08G100730	`PF13292`	DXP_synthase_N	416	435	0.00025	21.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84JL2`	Arabidopsis thaliana	sp\|Q84JL2\|ODBA2_ARATH 2-oxoisovalerate dehydrogenase subunit alpha 2, mitochondrial	71.500%	Swiss-Prot	High
`Q9LPL5`	Arabidopsis thaliana	sp\|Q9LPL5\|ODBA1_ARATH 2-oxoisovalerate dehydrogenase subunit alpha 1, mitochondrial	68.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card